Clone Read LE_HBa0131O24_SP6_112454

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0131O24_SP6_112454
Primer
SP6
ID from Seq. Facility
LE_HBa_131_O24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
157 trimmed for vector and quality, 779 raw
Sequence
>LE_HBa0131O24_SP6_112454 (raw untrimmed)
GTCTTCATTCATAAGGAAGCGTTACGAGATTCTTTTTTTTTTTTCTGAGCGTTTTACTAATTTGCATCGCACAAAATCAAAATCAAAAGAAAAAATTCGT
TNGACTCTCTAAAAAAATTAGACGTACCCTAACAAAACAATCATGGAAATGCATCCTGATAATGCCAGCGCCAAGGCCAGGGTTACGAGAGACGGCTTTG
TTGACTGCTTTTCTGACAATGGATTCTGCATTTGGGCAACTAGAATGGCACAAACCAATCTTAAGAGATGCAATTGCATCTGTATAAACAGTTGAAAAAA
TATAATATGAACAAATTTGACAATTTTATCTGTATGTGTTTTATTTATACGGATCTGAAAAGTGGAGTAATTTACATAGTATTGATGACAAATTTAAAAC
TAAATTACTTCTGCTGATAAGGACTCTACTACGTTGTCTATATATACGATCGGTCGTCCTTCCTTCTTCCTGTTCAGTTCGTATAGGCACTAACGCTTTA
TGTTATGAGTAGGAAACAATAGTCTTTATTATTTAGGTTACGTTGCAACCTGATAAATAATTTACTTTTCGAATTTATAGAACTACTTCACATAGCCTCT
CTTTCTATTCCTCTCACATCTCTAATTCTATTCCCCCATCTCATACACGCATCACCTACTCTCCTTTTCTCGCTGCCCTACTCAACCTACTCATTATCAC
GCCACACACACATACTCTAACTTCGACACTGTCAGCTACCATCCACATCTCACTCGAACAATTATAGCCCATAACCATA
>LE_HBa0131O24_SP6_112454 (trimmed for quality and cloning vector)
CGCACAAAATCAAAATCAAAAGAAAAAATTCGTTNGACTCTCTAAAAAAATTAGACGTACCCTAACAAAACAATCATGGAAATGCATCCTGATAATGCCA
GCGCCAAGGCCAGGGTTACGAGAGACGGCTTTGTTGACTGCTTTTCTGACAATGGAT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953642
Expected error %
3.7154
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0131O24
Clone
Clone name
hba-131o24
LE_HBa0131O24
C01HBa0131O24
P131O24
Clone type
BAC
Contamination
none
Estimated length
252,143
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found