Clone Read LE_HBa0181C24_T7_112647

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0181C24_T7_112647
Primer
T7
ID from Seq. Facility
LE_HBa_181_C24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
3 trimmed for vector and quality, 1202 raw
Sequence
>LE_HBa0181C24_T7_112647 (raw untrimmed)
TGTCGTTTCATAACCTACTATAGCTATTCCTCGAGGGGAGTTTACTTGTTATATTATTTAAGCCTTACTTTGTTTTGTTATTGCTTCGCGGTATTATTTG
AAATATTCAATATCACCACACCCCCTCTCCCTTGTGACGCACTAACACGTCGGGACGTGCTAGCGTACTCGCCTTCCGGGGAGCATCCCCGCCCTGGGAG
AGGGCGAAAAGCTAACATGATTGTTCGAATGTATATCTTACAAGCACATACAAGCTCTCTTACTCGTCACACGGTCGGCATCTAACACCACGTAGNTTTC
GTCATAATACTCAACATTATCGCAAATACACCGCAGTGTGGGCAGAATACTACCAGATTGTGAGAGGTGCGACGACTATCTAATAACACATATACGCCTA
CTCACAGTGACCGTTTCTAGTGCGGTGCTTGGTGATAGAGTAGGACTCGGCTATGTGTAGTTGTGCCGCACACACCGAGGTGCCTTTCTGCTTCGCTCTA
TGTAAGCAGTTTCATCGGGANGCAGTAACATTGAGTTGCTTGGTTGATGAACAGACAGTGTATGTTTCAATATTTAATATTCTTATCATGCGTGTCTCCA
TCATGACCTCCTCACACAATATCCAATCGTGTTAAATCCTTCGAAACAATATCACGATGTAAGAGTACAAGTAGTAGTTCCCGTCACTCATTAGTTGCTA
TCACGTCACTACTGTTGATATCAAGCTTCCGTCGCGCTACGGCATGCCTCTACATATGACAATGGACGGACAATGACGTGTTACTCCAAGTCACCAACCA
CTACGCTCTCACCCCATAGTTCTACATGATACTACACACAGCACATGCCTATGGACCAGCACCTCACTAGTCAGACGACAACAAGAGATAGCTGTTGCTA
CTAACTTTACAATATCATAAGTATTATAAATTACAACATTAACATCTGGCATCAGTACAAATAGTTATATGGACGGAACGAAATGCAGTCGTTTAGCTCA
GGAGATTGTAGAA
AGTACGAATCTTACCCAATACTACGAACGGTACCAACCACGTTCAGTACGTCTGCCTGCTGGGATACTCGTATCTGGTCACTTGTGA
TAGAACTGACGTACTGGCATGCTTTATCATCTTCTATACCTGAATTGCGGCCGGTGGTTTCTGGTAGCGCCCTGCCTTGATATTTATTCGAATGCACTGC
AA
>LE_HBa0181C24_T7_112647 (trimmed for quality and cloning vector)
AGT

This is probably not a useful sequence.

Problems:
  • Low complexity
  • High predicted error rate
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
3.6818
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0181C24
Clone
Clone name
hba-181c24
LE_HBa0181C24
P181C24
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found