Clone Read LE_HBa0181H03_SP6_112844

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0181H03_SP6_112844
Primer
SP6
ID from Seq. Facility
LE_HBa_181_H03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
677 trimmed for vector and quality, 999 raw
Genbank Accession
Sequence
>LE_HBa0181H03_SP6_112844 (raw untrimmed)
CCCAGTCATTCCTCATAATAATAATTACTCTATTTATCTCTGTGATATTTCTATCTTCTTCTTCTTCTAAAACGTCAAATTTTGAAATTTGAAAATTTGA
AAAATGGAGGGGACCATTAGATGCTCTGCAAATTACGTTTCGTTGAGTCCGATAAGTTTTTTGTTAAGGTCAGGTGTTGTATACAGCAACAGAATTTCTA
TCGTTTATGGCGATGTTAAGTTTACTTGGGCGGAGACAAGACGAAGGTGCTTACAACTTGCTTCTGCTTTTACTCATCTTGGAATTTCTCGTGGCGATGT
CGTATGTTCTCTTCCGATCCCCATTTGGTCTATTGATTTTGAAGTTGAAATTTTACGAATTATATGCTATTTTGTTTGATCATATTGTTGATTTTTATAA
ATTTGAAGTTTTGTTTGAATATTTGTTTCAGTTGATGGACAAATAGATATTTGGGATTTTTCACATAATCCAAACGATTTTCACTTAAAAATATATAATA
TATATAGCGATCAAGTTTTAATTTTTTTTATTAATTTTATGATTTAAGAATGATCGATCTTTCAAGTTAACAGAGTCGTCACTTGATTTTCACTAAAAAT
CAAGAAAAAACTTAAAATTAATTTTTGATCGCCAATTTGACTAAAATCACCTATTAAAATAACTTTTTTCCAATATTGAAACTAGGTGGAAAAAATTTAT
TTACCTATTTACCATTATCATTTTATAATGAATTACTTTAGGGGAAAAAGGGAGATCAGAGTAATGACTTTAAATGATTGATAAGACTAACTAAAAGTTA
AGTGATTTGTACAGAACTAATTTATTTTTATTATAAAAGAATGGTCTTTTCCGAAACTTTATTAAATTAAACCTTAAAATATTTCAGTTTGTAAAATAAT
ACAAAAATTTAAATGAAAATTGGTTTAAATTTGGCCTTGGGCCAATATTGAGCTGTCTTAACTTAAGTACCTAAATTGATTTGCCTTTTTTGCTTTTCA
>LE_HBa0181H03_SP6_112844 (trimmed for quality and cloning vector)
ATTACTCTATTTATCTCTGTGATATTTCTATCTTCTTCTTCTTCTAAAACGTCAAATTTTGAAATTTGAAAATTTGAAAAATGGAGGGGACCATTAGATG
CTCTGCAAATTACGTTTCGTTGAGTCCGATAAGTTTTTTGTTAAGGTCAGGTGTTGTATACAGCAACAGAATTTCTATCGTTTATGGCGATGTTAAGTTT
ACTTGGGCGGAGACAAGACGAAGGTGCTTACAACTTGCTTCTGCTTTTACTCATCTTGGAATTTCTCGTGGCGATGTCGTATGTTCTCTTCCGATCCCCA
TTTGGTCTATTGATTTTGAAGTTGAAATTTTACGAATTATATGCTATTTTGTTTGATCATATTGTTGATTTTTATAAATTTGAAGTTTTGTTTGAATATT
TGTTTCAGTTGATGGACAAATAGATATTTGGGATTTTTCACATAATCCAAACGATTTTCACTTAAAAATATATAATATATATAGCGATCAAGTTTTAATT
TTTTTTATTAATTTTATGATTTAAGAATGATCGATCTTTCAAGTTAACAGAGTCGTCACTTGATTTTCACTAAAAATCAAGAAAAAACTTAAAATTAATT
TTTGATCGCCAATTTGACTAAAATCACCTATTAAAATAACTTTTTTCCAATATTGAAACTAGGTGGAAAAAATTTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.918116
Expected error %
0.5417
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g76290.1 Score 98 E Value 4e-21 Identity 21.40% Align. Length 209bp (30.87%) Frame 1
68414.m08860 AMP-dependent synthetase and ligase family protein similar to AMP-binding protein GI:1903034 from [Brassica napus]; contains Pfam AMP-binding domain PF00501
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g20560.1 Score 97 E Value 6e-21 Identity 22.10% Align. Length 212bp (31.31%) Frame 1
68414.m02563 AMP-dependent synthetase and ligase family protein similar to AMP-binding protein GI:1903034 from [Brassica napus]; contains Pfam AMP-binding domain PF00501; identical to adenosine monophosphate binding protein 1 AMPBP1 (AMPBP1) GI:20799710
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||G86338 Score 99 E Value 1e-19 Identity 20.10% Align. Length 233bp (34.42%) Frame 1
protein F2D10.4 [imported] - Arabidopsis thaliana gb|AAF80642.1| F2D10.4 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_177756.1| Score 98 E Value 2e-19 Identity 21.40% Align. Length 209bp (30.87%) Frame 1
AMP-dependent synthetase and ligase family protein [Arabidopsis thaliana] gb|AAF16671.1| putative AMP-binding protein; 80053-82018 [Arabidopsis thaliana] pir||D96790 probable AMP-binding protein, 80053-82018 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0181H03
Clone
Clone name
hba-181h3
LE_HBa0181H03
P181H03
Clone type
BAC
Contamination
none
Estimated length
89,637
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found