Clone Read LE_HBa0181H03_T7_112845

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0181H03_T7_112845
Primer
T7
ID from Seq. Facility
LE_HBa_181_H03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
755 trimmed for vector and quality, 822 raw
Genbank Accession
Sequence
>LE_HBa0181H03_T7_112845 (raw untrimmed)
GCCGGGACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAACTTCAGCAGAAGTTGGACGCCTCATTAAGAAGCTCCTGGAAACCTCACC
GGATATTCTCAGACAATATATCATTCAACTACAAGGGCATATGATAACTGTTATTCACCCTAGCACTTCAGGGGCTCGAAACATTCATGTCATGATGGAA
TTCCTATTACTTATTCTTTCTGATATGCCCAAGGACTTTATTCATCATGACAAACTTTTTGATCTCTTGGCTCATGTCGGAGTACTTACCAGGGAGGTAT
CAACTCTTGTACGTGACTTGGAAGAGAAATTAAGGAATAAAGAGGGTAATAACCAAACAAATTGTGCAACCCTAGACTTGCTGGAAAATATTGAACTCCT
CAAGAAAGATCTCAAACATGTTTATCTTAAAGCCCCGGATTCATCTCAATGTTGCTTCCCCATGAGTGATGGACCACTCTTCATGCATCTTCTACACATG
CACTTAAATGATTTGCTAGATTCTAATGCTTATTCAATTTCTTTGATAAAGGAAGAAATCGAGTTGGTGAGACAAGACCTGGAATTCATAAGATCATTCT
TTGTGGATGCTGAGCAAGGATTGTATAAAGATATCTGGGCACGTGTCCTAGATGTGGCTTATGAGGCAAAAGATGTCATAGATTCAATTATTGTTCGAGA
TGATGGTCCCTTACATCTTATTTTCTCACTTCCCATTACCATAAAGAAGATAAAACTTATCAAAGAAGAGATCTTTGCTTTAGATGAGAACTTTCCCAAG
GGAAGAAGGTCTAATCGTTGTG
>LE_HBa0181H03_T7_112845 (trimmed for quality and cloning vector)
AGCTTCAACTTCAGCAGAAGTTGGACGCCTCATTAAGAAGCTCCTGGAAACCTCACCGGATATTCTCAGACAATATATCATTCAACTACAAGGGCATATG
ATAACTGTTATTCACCCTAGCACTTCAGGGGCTCGAAACATTCATGTCATGATGGAATTCCTATTACTTATTCTTTCTGATATGCCCAAGGACTTTATTC
ATCATGACAAACTTTTTGATCTCTTGGCTCATGTCGGAGTACTTACCAGGGAGGTATCAACTCTTGTACGTGACTTGGAAGAGAAATTAAGGAATAAAGA
GGGTAATAACCAAACAAATTGTGCAACCCTAGACTTGCTGGAAAATATTGAACTCCTCAAGAAAGATCTCAAACATGTTTATCTTAAAGCCCCGGATTCA
TCTCAATGTTGCTTCCCCATGAGTGATGGACCACTCTTCATGCATCTTCTACACATGCACTTAAATGATTTGCTAGATTCTAATGCTTATTCAATTTCTT
TGATAAAGGAAGAAATCGAGTTGGTGAGACAAGACCTGGAATTCATAAGATCATTCTTTGTGGATGCTGAGCAAGGATTGTATAAAGATATCTGGGCACG
TGTCCTAGATGTGGCTTATGAGGCAAAAGATGTCATAGATTCAATTATTGTTCGAGATGATGGTCCCTTACATCTTATTTTCTCACTTCCCATTACCATA
AAGAAGATAAAACTTATCAAAGAAGAGATCTTTGCTTTAGATGAGAACTTTCCCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960502
Expected error %
0.9904
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC97933.1| Score 397 E Value 1e-109 Identity 27.90% Align. Length 752bp (99.60%) Frame 3
disease resistance protein [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC67238.1| Score 397 E Value 1e-109 Identity 27.90% Align. Length 752bp (99.60%) Frame 3
root-knot nematode resistance protein [Lycopersicon esculentum] pir||T06269 root-knot nematode resistance protein Mi-1.2 - tomato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0181H03
Clone
Clone name
hba-181h3
LE_HBa0181H03
P181H03
Clone type
BAC
Contamination
none
Estimated length
89,637
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found