Clone Read LE_HBa0181K18_T7_113019

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0181K18_T7_113019
Primer
T7
ID from Seq. Facility
LE_HBa_181_K18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
562 trimmed for vector and quality, 862 raw
Sequence
>LE_HBa0181K18_T7_113019 (raw untrimmed)
TGCTCGGGCCCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAGCTGCAGCTTAAGTTAGACGCCCCTTTGAGAAGCTCCTGGAGACCTCA
CGGGATATTCTGGAACATTATCTCATTCAACTACTGGGGGATATGAAAACTGTTATTCACTCTAGGACTTCTGGGGCTCGAAGGATTCATGTCATGATGG
GATTCCTATTACTTATTCTTTCGAATATTCCCAGAGAATGAATTCATCATGAGAAACATTTTTGATCTCTTGGATCATGTCGGAATACGTACGAGGGAGG
TATAGACTCTTACACATGACATGGAAGAGAAATTAATGAATAAATAGGGAAATAACCAAACAAATTGTGTAATCCTAAACTTGTTGGAAAATATTGTACT
CTTCAAGAAAGATCACCAACATGTTTATCTTAAAGCCCCAGATTCATCTCATTGTAGCTTCCCCATGAGTGATGGACCACTCTTCATGCATCTTCTACAC
ATGCACTTAAATGATTTGCTAGATTCCAATGCTTATTCAATTTCTTTGATAAAGGAAGAAATCGAGTTGGTGAGACAAGACCTGGAATTCATAACATCAT
TCTTTGTGGATGCTGAGCAAGGATTGAAAAAAAATATCTGGGGAACGTGTCCTAGATGTGGTTTATTAGGCAAAAGATGTTATAGATTCAATTATTTGTT
TCGAGATTGATGGTATCCAAAATTTTTATTTTTTCTCTTCCCCATTACCATTATAAAAGACCAAATCTTATTACTGAATAGATCCTTTGCTTTTATATGA
TATACATTCCTATTGAATACAGGGTTATAATTTGTTATTTAACCCTTTTCGCTGTAAAATTT
>LE_HBa0181K18_T7_113019 (trimmed for quality and cloning vector)
AGCTTCAGCTGCAGCTTAAGTTAGACGCCCCTTTGAGAAGCTCCTGGAGACCTCACGGGATATTCTGGAACATTATCTCATTCAACTACTGGGGGATATG
AAAACTGTTATTCACTCTAGGACTTCTGGGGCTCGAAGGATTCATGTCATGATGGGATTCCTATTACTTATTCTTTCGAATATTCCCAGAGAATGAATTC
ATCATGAGAAACATTTTTGATCTCTTGGATCATGTCGGAATACGTACGAGGGAGGTATAGACTCTTACACATGACATGGAAGAGAAATTAATGAATAAAT
AGGGAAATAACCAAACAAATTGTGTAATCCTAAACTTGTTGGAAAATATTGTACTCTTCAAGAAAGATCACCAACATGTTTATCTTAAAGCCCCAGATTC
ATCTCATTGTAGCTTCCCCATGAGTGATGGACCACTCTTCATGCATCTTCTACACATGCACTTAAATGATTTGCTAGATTCCAATGCTTATTCAATTTCT
TTGATAAAGGAAGAAATCGAGTTGGTGAGACAAGACCTGGAATTCATAACATCATTCTTTGT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.958657
Expected error %
4.6029
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC97933.1| Score 148 E Value 7e-52 Identity 67.20% Align. Length 558bp (99.29%) Frame 3
disease resistance protein [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC67238.1| Score 148 E Value 7e-52 Identity 67.20% Align. Length 558bp (99.29%) Frame 3
root-knot nematode resistance protein [Lycopersicon esculentum] pir||T06269 root-knot nematode resistance protein Mi-1.2 - tomato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0181K18
Clone
Clone name
hba-181k18
LE_HBa0181K18
P181K18
Clone type
BAC
Contamination
none
Estimated length
85,438
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found