Clone Read LE_HBa0051E01_SP6_11328

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0051E01_SP6_11328
Primer
SP6
ID from Seq. Facility
LE_HBa_051_E01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
703 trimmed for vector and quality, 820 raw
Genbank Accession
Sequence
>LE_HBa0051E01_SP6_11328 (raw untrimmed)
TTGCTTAACTAATTAGATTATTAAATATCTAAATATTTTTTAAAAAAATATTTGTCCTAATTTTGAATGTGTTCTAAAGATAATAATCACTATAATAATG
AATTTTATGATTAAAAATATTACGAAATGTTAAATAAGTAAAGAAATGGTACTCTACTTCCCAAATTTAGTGAAGTGAAATTTTAATTTTAGTATAATTT
TGAGAGTTTATGTAACAACTAATTTTATTGCAAAAACTTTCAAAAATATAATCAATCAGAGAGATTTAAACACTTGTGTTGTTATAGTACAATAATTTAT
ATATGGTTATTTTTGTCTAACAAAGTATTAAGAAAAAGGTTATACAATTGAAAAATAAAAAATAATTATTAAATTAATTAAAATATTTTCTTTTAGAATT
TATGAAGGTAATGTGTGTATATATATAAAGAAATTATTTTTTTTTTTCTAAAATTTGGCTTTACATCCCTTGATTTACGAATACATAAAATCCAATATAT
ATCATCAACATAACTATATCATTGAATACGCCCGGCCCCCCTCATCCCTTTTGGTTTGGGGACGACAAGTACTTCGTCTCGAGTAGGACACCGGTGATCT
CTACATTCACCTATGTAATTTCTAAATCTGCTTTCAAGCAGCTCCGTTTTCTAAGGGAGAGTGGACTAAAAAAAGGAGAAACGTCATGCGTCATGCTTTT
TTGTAGACCAGCTAGTATACATTAAAGAAAGTGGCTTCCTCAATTAAACTAGCTTCCTCATCTTCTCTTTCCCCAACAATTTGCAAAATAGGAGAAAATT
GATATCATTTCTTTTTTTTC
>LE_HBa0051E01_SP6_11328 (trimmed for quality and cloning vector)
TTAGATTATTAAATATCTAAATATTTTTTAAAAAAATATTTGTCCTAATTTTGAATGTGTTCTAAAGATAATAATCACTATAATAATGAATTTTATGATT
AAAAATATTACGAAATGTTAAATAAGTAAAGAAATGGTACTCTACTTCCCAAATTTAGTGAAGTGAAATTTTAATTTTAGTATAATTTTGAGAGTTTATG
TAACAACTAATTTTATTGCAAAAACTTTCAAAAATATAATCAATCAGAGAGATTTAAACACTTGTGTTGTTATAGTACAATAATTTATATATGGTTATTT
TTGTCTAACAAAGTATTAAGAAAAAGGTTATACAATTGAAAAATAAAAAATAATTATTAAATTAATTAAAATATTTTCTTTTAGAATTTATGAAGGTAAT
GTGTGTATATATATAAAGAAATTATTTTTTTTTTTCTAAAATTTGGCTTTACATCCCTTGATTTACGAATACATAAAATCCAATATATATCATCAACATA
ACTATATCATTGAATACGCCCGGCCCCCCTCATCCCTTTTGGTTTGGGGACGACAAGTACTTCGTCTCGAGTAGGACACCGGTGATCTCTACATTCACCT
ATGTAATTTCTAAATCTGCTTTCAAGCAGCTCCGTTTTCTAAGGGAGAGTGGACTAAAAAAAGGAGAAACGTCATGCGTCATGCTTTTTTGTAGACCAGC
TAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.909148
Expected error %
0.187661
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0051E01
Clone
Clone name
hba-51e1
LE_HBa0051E01
P051E01
Clone type
BAC
Contamination
none
Estimated length
70,390
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found