Clone Read LE_HBa0051E01_T7_11329

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0051E01_T7_11329
Primer
T7
ID from Seq. Facility
LE_HBa_051_E01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
803 trimmed for vector and quality, 894 raw
Genbank Accession
Sequence
>LE_HBa0051E01_T7_11329 (raw untrimmed)
TAAACTTGGTCCCGCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAATTTTCTTGCTAATACAAGAATGTATATAACATACAGTGTCCAGCA
TCTTAGCCAATTCATGCTATCTCCTAGAGAGCCTCATCTAAAGGCAGCTTATCATGTGCTCAGGTATCTACAACATGATCCTACTTTGGGAGTCTTTATC
AATAATAAGCCTGATGTCACTGTTAGTGCTTATTGTGATTCAGATTGGGCTTCTTGTCCTGATTCAAGAAAGTCTGTAAGTGGTTATTTGGTTCTCATGG
GAGATAGCCCTATCAGCTGGAAATCTAAGAAGCAACCCACAGTGTCACTATCATCAGCAGAAGCAGAATACAGAGCTATAAGACAAGTGGTAGGAGAAGT
AGTGTGGCTGGAAAGGTTACTTGGTGAACTCTCAATGACAGTGTCCTTACCAATACATGTGTTTTGTGACAGCCAAGCAGCAGTACACATTGCTAGGAAT
CCAATATTTCATGAACGAACCAAGCACATAGAAGTTGATTGCCATTTCGTCAGGACAAAGCTACAAGAAGGACTGATTACACTCCAATACATTCCAACAG
ATTCTCAGCTAGCTGATGTTTTTACTAAGTCTTTAACTGGGGTCAAACATACTACTTTGATGAGCAAGTTGTCTGTAGGTAGATTACTTCCAACTTGAGG
AGGGGTGATAAAACTTGCCTAGTTAGTTAATTAGCTTAAGTAGTTAGTTAGTTACTAATTAGCTAATTAGTTATAGTTGGTTGTAGTTAGTTAAAGTTAG
TTAGAAGTCACATTTTCCACACTTTTGTTATTTTGTAATTCTGTTAGATTGTGAATATGGTTGTGGATATAACTTGCACATTTAACTGGTTAAT
>LE_HBa0051E01_T7_11329 (trimmed for quality and cloning vector)
AGCTTAATTTTCTTGCTAATACAAGAATGTATATAACATACAGTGTCCAGCATCTTAGCCAATTCATGCTATCTCCTAGAGAGCCTCATCTAAAGGCAGC
TTATCATGTGCTCAGGTATCTACAACATGATCCTACTTTGGGAGTCTTTATCAATAATAAGCCTGATGTCACTGTTAGTGCTTATTGTGATTCAGATTGG
GCTTCTTGTCCTGATTCAAGAAAGTCTGTAAGTGGTTATTTGGTTCTCATGGGAGATAGCCCTATCAGCTGGAAATCTAAGAAGCAACCCACAGTGTCAC
TATCATCAGCAGAAGCAGAATACAGAGCTATAAGACAAGTGGTAGGAGAAGTAGTGTGGCTGGAAAGGTTACTTGGTGAACTCTCAATGACAGTGTCCTT
ACCAATACATGTGTTTTGTGACAGCCAAGCAGCAGTACACATTGCTAGGAATCCAATATTTCATGAACGAACCAAGCACATAGAAGTTGATTGCCATTTC
GTCAGGACAAAGCTACAAGAAGGACTGATTACACTCCAATACATTCCAACAGATTCTCAGCTAGCTGATGTTTTTACTAAGTCTTTAACTGGGGTCAAAC
ATACTACTTTGATGAGCAAGTTGTCTGTAGGTAGATTACTTCCAACTTGAGGAGGGGTGATAAAACTTGCCTAGTTAGTTAATTAGCTTAAGTAGTTAGT
TAGTTACTAATTAGCTAATTAGTTATAGTTGGTTGTAGTTAGTTAAAGTTAGTTAGAAGTCACATTTTCCACACTTTTGTTATTTTGTAATTCTGTTAGA
TTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950632
Expected error %
0.729349
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 165 E Value 2e-41 Identity 13.70% Align. Length 626bp (77.96%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD19784.1| Score 242 E Value 7e-63 Identity 18.60% Align. Length 635bp (79.08%) Frame 1
putative retroelement pol polyprotein [Arabidopsis thaliana] pir||C84512 probable retroelement pol polyprotein [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89730.1| Score 240 E Value 3e-62 Identity 17.70% Align. Length 626bp (77.96%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0051E01
Clone
Clone name
hba-51e1
LE_HBa0051E01
P051E01
Clone type
BAC
Contamination
none
Estimated length
70,390
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found