Clone Read LE_HBa0188K14_T7_113779

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0188K14_T7_113779
Primer
T7
ID from Seq. Facility
LE_HBa_188_K14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
581 trimmed for vector and quality, 843 raw
Genbank Accession
Sequence
>LE_HBa0188K14_T7_113779 (raw untrimmed)
TGGGGCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAAATTTCTTCTCCATATCCCCGTAAGGGGGAAGTTATTTCCCTCGTCAATTC
ATAAATATACCTTTTGGGGGGTAGGTATACTCATTCTTTTTCACCTTCCTCCAGCAAGCAGAATCATGAAACGTTAGAAAATATCTATTTTCAAAATCTA
ATTTTTCATTCAAAAATCAATTTTATTTATCTTTAATAAATTACATCACATGATACATAGCATTGTTAAAATTATCATGTGCTGAACAAATAATCTTGAA
GAAGAAGAAGAAAGGTTGATATCATTCAAGAGTAAACATGTGGTTATGTTTGGAATTGAGAATTTAACCTAATTAAAAAAAATAAGTTAAAAAACGTGAG
GTCTATTGCATCTGTATCTTGAAATAAACAAGAAAATAAAATTAAATAAAATGGGCCCACCTAGCGCGTGTATTCAAACATATGTGTATATCTGGGTATG
ACAAAAGTTGAGCGTTTAAGGGTTATAAAATATCAAAAATAAAAAGTTCAGCAGGGTAATAGGACTCCCATAAAATTTAGGTGTGTAGTTGAGGATTGAC
TAATAGGGCTGAGGGGTCATTTGACTGTTTTCTCGAATTATTGTAATAAATAATGGTCTACCACTCTTATAATAGGTAAAGAGGTTGGAAGTAAGTGTGA
TCCGATGTGAAGCGCGTATCTTGGCAACCGGCGACGCCTTGTCTTATTTGTGGAGGGAGTGTTGTGCATGTTGTCGGGTGCCTGGCGTTAATCTTGGTTC
CGGTATATTGGGGGTTTGCTCTGTGTGCTATGAAGGTGCGTGT
>LE_HBa0188K14_T7_113779 (trimmed for quality and cloning vector)
AGCTTGAAATTTCTTCTCCATATCCCCGTAAGGGGGAAGTTATTTCCCTCGTCAATTCATAAATATACCTTTTGGGGGGTAGGTATACTCATTCTTTTTC
ACCTTCCTCCAGCAAGCAGAATCATGAAACGTTAGAAAATATCTATTTTCAAAATCTAATTTTTCATTCAAAAATCAATTTTATTTATCTTTAATAAATT
ACATCACATGATACATAGCATTGTTAAAATTATCATGTGCTGAACAAATAATCTTGAAGAAGAAGAAGAAAGGTTGATATCATTCAAGAGTAAACATGTG
GTTATGTTTGGAATTGAGAATTTAACCTAATTAAAAAAAATAAGTTAAAAAACGTGAGGTCTATTGCATCTGTATCTTGAAATAAACAAGAAAATAAAAT
TAAATAAAATGGGCCCACCTAGCGCGTGTATTCAAACATATGTGTATATCTGGGTATGACAAAAGTTGAGCGTTTAAGGGTTATAAAATATCAAAAATAA
AAAGTTCAGCAGGGTAATAGGACTCCCATAAAATTTAGGTGTGTAGTTGAGGATTGACTAATAGGGCTGAGGGGTCATTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.930963
Expected error %
1.0377
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0188K14
Clone
Clone name
hba-188k14
LE_HBa0188K14
P188K14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found