Clone Read LE_HBa0191D05_T7_114193

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0191D05_T7_114193
Primer
T7
ID from Seq. Facility
LE_HBa_191_D05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
532 trimmed for vector and quality, 978 raw
Genbank Accession
Sequence
>LE_HBa0191D05_T7_114193 (raw untrimmed)
TGAAGTGGGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGTATTAGAGCATAAAATTTTCGGGATAATAGTACGGTTGATGCCAC
ACACCACCATGTCAAGTAGAGTCTTATTCATAATGTGAAACACTCCACCTTTATGAATAGGAGGTTCTAAGATGATTAGGAACCCTTCTTTCTTTATTAT
TCTATGATCGTGGTGGAGTCTTAACACTATGTATTTAACTCATTCCTTATAATCCATTTCATGTGCTTATAGTCCTTGAATACAATGAGGGATAATGATA
GTTGGGTCGAAGAGAAAAATGTGAATGAGGAGGTTCCCCCTCATAGTTGAGATAAGGTCTTCCATCTATAGTTTGACTCAAGTGTTGGATACTCAAATTG
ATAAAGATGATATGGTGAAAGTGAATCCCAATGCTAGCACCACTTCTTCAAGAATAAGGAATTTCACAAGGATTAATAACCCTAAGTTCTTTGACTCTAA
GGTGGAAGAATACCCACAAGAATTTATAGATGAAGTATTCTAGGGGGGAGATGCCATGAGAGTGACCTCTCAAGAAAAGGTGAAATTAGTCGTCTATCAA
TCTAAAGAAGTGTCTCAAGTTTTGTATTGAACAATAGATGGGTGATAGGTCTGTTATGCGATTGTAGATTACTTTTCATGGGGTTATTCCTAATGCCTTT
TCTTGTTTTGTTTATTTTCTTCAAACTAATAGATAACAAAAGTTAAAGCTTTCACCTCTTCTTCTTGTATAACACGAGTTTCTTTTATTAGGTTTGAATT
TTTGTGTAAATTTTTGAGTGTATTGCTAAATCTTTATTGGATCCTGTCTATTTTATTTATTTTTTCATATTTTGTTTACTGAGTGTTTTACATTTAGTTT
AATTCTCTACTCTCTTGCCATCATCCCGCTCAGATGCAGTAGAACTATCAACACACTTGAAGACACAGATACCTACTG
>LE_HBa0191D05_T7_114193 (trimmed for quality and cloning vector)
AGCTTGGTATTAGAGCATAAAATTTTCGGGATAATAGTACGGTTGATGCCACACACCACCATGTCAAGTAGAGTCTTATTCATAATGTGAAACACTCCAC
CTTTATGAATAGGAGGTTCTAAGATGATTAGGAACCCTTCTTTCTTTATTATTCTATGATCGTGGTGGAGTCTTAACACTATGTATTTAACTCATTCCTT
ATAATCCATTTCATGTGCTTATAGTCCTTGAATACAATGAGGGATAATGATAGTTGGGTCGAAGAGAAAAATGTGAATGAGGAGGTTCCCCCTCATAGTT
GAGATAAGGTCTTCCATCTATAGTTTGACTCAAGTGTTGGATACTCAAATTGATAAAGATGATATGGTGAAAGTGAATCCCAATGCTAGCACCACTTCTT
CAAGAATAAGGAATTTCACAAGGATTAATAACCCTAAGTTCTTTGACTCTAAGGTGGAAGAATACCCACAAGAATTTATAGATGAAGTATTCTAGGGGGG
AGATGCCATGAGAGTGACCTCTCAAGAAAAGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959388
Expected error %
0.5187
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38733.1| Score 89 E Value 6e-17 Identity 19.70% Align. Length 233bp (43.80%) Frame 2
putative retrotransposon gag protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0191D05
Clone
Clone name
hba-191d5
LE_HBa0191D05
P191D05
Clone type
BAC
Contamination
none
Estimated length
120,083
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found