Clone Read LE_HBa0191H06_T7_114387

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0191H06_T7_114387
Primer
T7
ID from Seq. Facility
LE_HBa_191_H06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
547 trimmed for vector and quality, 974 raw
Genbank Accession
Sequence
>LE_HBa0191H06_T7_114387 (raw untrimmed)
TGACTGGGGTCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATTCTTCCAGAGCAACATCCTCTATAGGGGATGATCAAAATGTTAACG
AGTAGTCAAGACCTTCAAGGGGATGAATGCCAGAAGTGCAGCCTGCTGCATCTTTTCACATAGATATGCAGGCGAACGAGTTACTTTACTTGTACAATTC
CTTGAATCTTCTGCAAGCTTCAATGACTTTTTCCCTGTGCCCAAAAGCACTCACTCTCACAAAACCTTCACCACCATTCCCTAAACTACTGCCTGGAGTA
GTAACGACATGAGTCTTCTCAAGTATCTCGCTTAAAACCTCCCATGAGCTTCGTCCAGGGAAGTGTACCCAGACGTAGGGTGCATTTTTACCTCCATACA
CCTTGTTTTTCTTTCGAGTTAAATGTGTCCATTATGATTTGTGTGTTCTCTTTATAGTAACCAACCACGTCCATCATGGCCTGAAATGCAAGGTCAACAC
ACATACGTTCACATTGAACTCTTAAGCCTATTATAATGATGTTATTTATATGATTACGCGAATAGGGAGCCCCCCCCGCAACCATCAGGTGAAAGGCAAG
CCAGACCACCAGTTTGAGTCAATGTTTGATGCACCATTGAAGCATTTACAAACTTTGTTTTTTTTTTCTTTTTTTTATTTGTTTTTCTTTTTTTTTTTTT
ATTTTTTTGTGTCATTTTTTTTTTTTTTTTATTAATTTCTTTTTATTTTTTTTTTTTTTTTTAATTTTATTTCACCTTAAGGCGATCCATTAAGACGCTA
TGATATACTTACGTAATCTTTTTTACAATCATTAGAAAATATTGATATTTTATTCACCTTGTATAATACTCTTTTTTTTTTCTTCTTTTTTTTCTAATTT
TTTTTGTGTTTCTGTGTCTAAATTTTATTCTTTTTATTTTTATTTCTTTTATTTTCTTTTTCTTCTTCTTTTTT
>LE_HBa0191H06_T7_114387 (trimmed for quality and cloning vector)
AGCTTTATTCTTCCAGAGCAACATCCTCTATAGGGGATGATCAAAATGTTAACGAGTAGTCAAGACCTTCAAGGGGATGAATGCCAGAAGTGCAGCCTGC
TGCATCTTTTCACATAGATATGCAGGCGAACGAGTTACTTTACTTGTACAATTCCTTGAATCTTCTGCAAGCTTCAATGACTTTTTCCCTGTGCCCAAAA
GCACTCACTCTCACAAAACCTTCACCACCATTCCCTAAACTACTGCCTGGAGTAGTAACGACATGAGTCTTCTCAAGTATCTCGCTTAAAACCTCCCATG
AGCTTCGTCCAGGGAAGTGTACCCAGACGTAGGGTGCATTTTTACCTCCATACACCTTGTTTTTCTTTCGAGTTAAATGTGTCCATTATGATTTGTGTGT
TCTCTTTATAGTAACCAACCACGTCCATCATGGCCTGAAATGCAAGGTCAACACACATACGTTCACATTGAACTCTTAAGCCTATTATAATGATGTTATT
TATATGATTACGCGAATAGGGAGCCCCCCCCGCAACCATCAGGTGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.982456
Expected error %
2.4565
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g33680.1 Score 134 E Value 1e-36 Identity 83.10% Align. Length 294bp (53.75%) Frame 3
68417.m04784 aminotransferase class I and II family protein low similarity to Aromatic Aminotransferase from Pyrococcus horikoshii GP|14278621; contains Pfam profile PF00155 aminotransferase, classes I and II
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g13810.1 Score 98 E Value 9e-23 Identity 54.90% Align. Length 276bp (50.46%) Frame 3
68415.m01524 aminotransferase class I and II family protein low similarity to Aromatic Aminotransferase from Pyrococcus horikoshii GP|14278621; contains Pfam profile PF00155 aminotransferase, classes I and II
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM51321.1| Score 134 E Value 5e-35 Identity 83.10% Align. Length 294bp (53.75%) Frame 3
unknown protein [Arabidopsis thaliana] gb|AAL38732.1| unknown protein [Arabidopsis thaliana] ref|NP_567934.1| aminotransferase class I and II family protein [Arabidopsis thaliana] gb|AAL08279.1| AT4g33680/T16L1_170 [Arabidopsis thaliana] gb|AAR99909.1| aminotransferase AGD2 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB80085.1| Score 134 E Value 5e-35 Identity 83.10% Align. Length 294bp (53.75%) Frame 3
putative protein [Arabidopsis thaliana] emb|CAA20581.1| putative protein [Arabidopsis thaliana] pir||T04985 probable transaminase (EC 2.6.1.-) T16L1.170 [similarity] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0191H06
Clone
Clone name
hba-191h6
LE_HBa0191H06
P191H06
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found