Clone Read LE_HBa0191N05_SP6_114672

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0191N05_SP6_114672
Primer
SP6
ID from Seq. Facility
LE_HBa_191_N05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
214 trimmed for vector and quality, 837 raw
Genbank Accession
Sequence
>LE_HBa0191N05_SP6_114672 (raw untrimmed)
TTTTCTGAACTCCCTTTGGTAGATCTGTACATTTCTTTATCTCATATGCTTGACTATCCATTTAGTTGGCATGTTTCCGTAACATCTACTAATAGTATTT
CTTTTTATGGAGATGGTGTTGAATCGTGTCATTCTCCACACATCCTGGCCGTACACTTATGTAGATTCACTCTCAAGGAGTAAGTATTCTTTTACAACAA
AGAAGGCTACAATTGTAACACCATTACAACATTGTTGCCCTCTCTCGACCGCCAACGCCACTGTGGCTGCCGATACGCCATTAATTGTCAATGTCTTCAC
TTTCACCCTAACTTCACAAACTAATAAAAAATAACCGTGTGTGTTTACATCGACGCACAACCTAGGAAAACTC
TTGATGCATCACAATAGATCATATAAT
TATCATAACCTTTTGGAAGAACCAAAGTTAATATAGTTTTCAATTCAGCAAAGTTTTTCTCACAATCATTCGACCATTGATACTTGACAATCTTTTGAGT
CAACCTAGTCAATAGTGAGTCTATGGATGGAAATCATTCCACGAACCTTCTATAATAACCCACTAGACCTAAGAAACTTCTCATATCTATGGCAGGGGTA
GGTCTGGGACATTATTTCACTTCTTCCATCTTCTTGCGAATCCACTCCAAATCCCTGTCGGTAGATACTATGTAACTGAGGAAAGGCTATTCTTGGAACC
ATTAATCATAATAGGCTAGAGAAAAAAAATAAAAGGTGAAAGTTGAAAACCCGTTACACAGTGTCTCAAAACTAATACGGCTGTATATAGAAACCAGACC
CTTCTATCGTTCCCATGTCCTTATCCCTCCCAACCGC
>LE_HBa0191N05_SP6_114672 (trimmed for quality and cloning vector)
TTGATGCATCACAATAGATCATATAATTATCATAACCTTTTGGAAGAACCAAAGTTAATATAGTTTTCAATTCAGCAAAGTTTTTCTCACAATCATTCGA
CCATTGATACTTGACAATCTTTTGAGTCAACCTAGTCAATAGTGAGTCTATGGATGGAAATCATTCCACGAACCTTCTATAATAACCCACTAGACCTAAG
AAACTTCTCATATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.917378
Expected error %
0.3221
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31171.1| Score 93 E Value 2e-18 Identity 22.10% Align. Length 212bp (99.07%) Frame 3
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39297.1| Score 89 E Value 5e-17 Identity 20.70% Align. Length 212bp (99.07%) Frame 3
putative gag-pol protein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0191N05
Clone
Clone name
hba-191n5
LE_HBa0191N05
C03HBa0191N05
P191N05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found