Clone Read LE_HBa0191N05_T7_114673

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0191N05_T7_114673
Primer
T7
ID from Seq. Facility
LE_HBa_191_N05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
323 trimmed for vector and quality, 962 raw
Sequence
>LE_HBa0191N05_T7_114673 (raw untrimmed)
TTAGCTGGGTCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTACTGGAGCTCAGTTCTTAGCCTTTCAGGATATATTATTACGACTATGC
ATAAAGATCTTCCCCCTTAAAACTCTCATTCCCATACTCCTGTTGCGGTAATGGCTTTTCTCAGCAACTTATTCCCACCTCAATCTGATCTTAACTTAAC
TACTTTCCTTATCGACTTGGAAAGTGCTTACTACCCTAAGAACGATTTGTTTTGATTTAGCTTTTGATGATCACATGTGTTTTAAAGCTGATCGTCTAGG
CTGATTATTATTGATCATCATCTTAGGCCAGACTATTCTACCGAATACTGTTTCTGACCTATCGGAGAACACACGAGGGTCACTATACGTTATGGGAATC
TATTTCTGAGACATTGACTTGACGCCTCTTATGGTAAGATCAACTTCAGAGTGACGATACTTCAATGTCACATTGGATCTTCATCTATCGGCCTGCCCAT
ATTAGCCATGCGACCCTGTCTTCTATGATCCAGTTTATACGTGTTGACTACATATCTACACAAGGCAGCACAAATATTTAGGCCACATGCTCCTTTAGCT
ATTTACCCTGATTGTGAAATTATTTCTCCTCTTACACCTATCGTAACAATATTTGCCTGCACTGTCATATATCCTGACGACATTCCTAATTCGACTTATT
TTATCCGTAACCACTTCTAACAAGCTTTAACCGTATCGGGACGAACATTTTTCACATAACCTGGTCATTTCACATCTAGTTGAAACTCGCCACTAAGGGC
CTTCTCTTTTTTAAGCCCACAAAAACGTTTCTTTCTCTTTCTATAAAACCATAAACCAAGAGAACTATTAAATTTCCCTTTTCCCCTCCGGGTAAAAATT
ACTTTCATCCAACAAATCTAGGTAAAGAATACGTGCGAGATTCTTTTAAAAGACTTTTTGGG
>LE_HBa0191N05_T7_114673 (trimmed for quality and cloning vector)
AGCTTACTGGAGCTCAGTTCTTAGCCTTTCAGGATATATTATTACGACTATGCATAAAGATCTTCCCCCTTAAAACTCTCATTCCCATACTCCTGTTGCG
GTAATGGCTTTTCTCAGCAACTTATTCCCACCTCAATCTGATCTTAACTTAACTACTTTCCTTATCGACTTGGAAAGTGCTTACTACCCTAAGAACGATT
TGTTTTGATTTAGCTTTTGATGATCACATGTGTTTTAAAGCTGATCGTCTAGGCTGATTATTATTGATCATCATCTTAGGCCAGACTATTCTACCGAATA
CTGTTTCTGACCTATCGGAGAAC

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.954961
Expected error %
6.1311
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0191N05
Clone
Clone name
hba-191n5
LE_HBa0191N05
C03HBa0191N05
P191N05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found