Clone Read LE_HBa0004H22_T7_1147

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004H22_T7_1147
Primer
T7
ID from Seq. Facility
LE_Hba_004_H22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
772 trimmed for vector and quality, 1113 raw
Genbank Accession
Sequence
>LE_HBa0004H22_T7_1147 (raw untrimmed)
TTTAGCCTGGTACCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGTCTAGTCACAATTATTCTATATATCCTCTATCAAAAGCATGTACCC
AACAATTTTGCTTAACTCATATTCCTATCACATCCCAAGAATTCCCCATTTCATTGCTTTGATTTCTCATTTATATCGTTATTTTTAATACTTGTAAAAA
AGCCCATTGATAATTGATGTTTGCTTCACCCCCTTCTTTGATTTATAATGTGTTTACTCACTAATGTATTTAGCTATGACTAGTTAGAACGTAGTTTTAA
TTTTTTATTAATTCTCACTACCACTCACTTTTTACACGAACCCAACCCTTGGTTGGGTTACTATCTTATTCCACAATCCTAAACACGCGTACTGAAATTT
GTATCGTCGATTACGCAAACATCAATTACTGAAAGGATTCTATGGTCTGCTATGTACTAAGAGCTAACCCAGCGTTTACACTCGTGCTGGGATGTATCTT
AAGGATATGGGCTAAGCACGGAATGAATACAATCTCAATGCTAAGGAATGGTATAGTCCTAGTAAGGTTTGATACTTAAATGGAGAAGGAGGTTGCTATA
GAGGGTGGTATATATTACTTTGACAACAAACCTTCATCGTGAAGGCGTGGAATTCTTACATGGAGTTTACCAGAGAGGAACTCATAATTGTCCCTATTCG
GGTTATGTTTTGGGGATTAGACTTCAAGTACCAGAGTCCAAGGATGTTAAGTAACATAGGCAGCCTCGTGAGAAACAAATGATGGTGGATCAATGTGCTG
AGAAGAAATTGGGCCTCAACATTGCTAGATTAATATTGAAGATGGATATCGACTCTAACTAGACAAAAATGGTGGATCTCCCCGAATGAAAAAGTAACAA
AGATCACTAAAAGATTAAAAAATGATGGAAGGCCAATATGGTTTTTTTGACAAAATGTGTAAGAAGAAAAAAAACCCAAACCCGCATTGAGAAAGGCTCA
GCAAATTACTTGTTCACCAAGGAAAATACCATCTCAAAAAATTTGGGAAGGACCCCAGGCAGCATTCTTTAAAGGGCAAAAAAATGAATCCAATTAAAGA
TTTTACTGGGTTT
>LE_HBa0004H22_T7_1147 (trimmed for quality and cloning vector)
AGCTTAGTCTAGTCACAATTATTCTATATATCCTCTATCAAAAGCATGTACCCAACAATTTTGCTTAACTCATATTCCTATCACATCCCAAGAATTCCCC
ATTTCATTGCTTTGATTTCTCATTTATATCGTTATTTTTAATACTTGTAAAAAAGCCCATTGATAATTGATGTTTGCTTCACCCCCTTCTTTGATTTATA
ATGTGTTTACTCACTAATGTATTTAGCTATGACTAGTTAGAACGTAGTTTTAATTTTTTATTAATTCTCACTACCACTCACTTTTTACACGAACCCAACC
CTTGGTTGGGTTACTATCTTATTCCACAATCCTAAACACGCGTACTGAAATTTGTATCGTCGATTACGCAAACATCAATTACTGAAAGGATTCTATGGTC
TGCTATGTACTAAGAGCTAACCCAGCGTTTACACTCGTGCTGGGATGTATCTTAAGGATATGGGCTAAGCACGGAATGAATACAATCTCAATGCTAAGGA
ATGGTATAGTCCTAGTAAGGTTTGATACTTAAATGGAGAAGGAGGTTGCTATAGAGGGTGGTATATATTACTTTGACAACAAACCTTCATCGTGAAGGCG
TGGAATTCTTACATGGAGTTTACCAGAGAGGAACTCATAATTGTCCCTATTCGGGTTATGTTTTGGGGATTAGACTTCAAGTACCAGAGTCCAAGGATGT
TAAGTAACATAGGCAGCCTCGTGAGAAACAAATGATGGTGGATCAATGTGCTGAGAAGAAATTGGGCCTCAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.968956
Expected error %
0.611192
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004H22
Clone
Clone name
hba-4h22
LE_HBa0004H22
C12HBa0004H22
P004H22
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found