Clone Read LE_HBa0051K05_SP6_11624

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0051K05_SP6_11624
Primer
SP6
ID from Seq. Facility
LE_HBa_051_K05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
744 trimmed for vector and quality, 856 raw
Genbank Accession
Sequence
>LE_HBa0051K05_SP6_11624 (raw untrimmed)
AAATGGTTTTCTCCCTCATATTACNNNNCNNAAAGTGNCTTTNNCAAAGACAACTGAATTCTTTGCACTTTCCTGCTAGATTCGAGATGAATCTCCTAAG
ATATGCTAGCTTCCATTGCAGACTCTTCAATTCATGGATGTTTCTTGGCTCGACCATCTTTCAAATTGCATTTATTTTTGCTTGATCATTTTTTATTCCT
CGATGTCGTACAAGGAAACCAAGGAATTTTCTACACCATCCTCAAGTCTTTCAAGTGGTCACAATTTTTTCTTGATTTCACTTCTAACTCATCAACATAA
TATTCAACATTTTTGTGAAGAATTATATCTAAGATGTTCTGTATAGATCTTTAGTATGTTGCTCTTGCATTCTTTACAAAAGGTATTACTTTGTAGCAAT
AAATGCCATTTGGAGTCCACAAGGCGGTCAACTCTTCATCCTTTGGTGACATGCAAATCTGGTTGTAGCCGGATGAAGCGTCCATAAAAGACATCGCCTC
ATACCCAATAGTGCCATCAATCATAAGCTTAGGGATAGGAAGTGGAACTTCATATTTCGGATATGCATTATTGAGATCCCTTAAGTCAATACAAACTCAA
ATTTTCCCATTCTTCTTCTTCACGGGGATAATACTTGAAACCCATATGGGTACTTAACTTCATGAATAAAGCTAACCTCAATAAGCTTGTTAACTTCAGT
TTCTACCACAGGAACCAATCCAGTCCTAAAATGCCGTTGAGCTTGCTTGATGGGACGTGTACCACTTTTCACAACAAGATGATGGACTGCCACCTTCGGG
TCTAATCCAAGCATTGCTTTGTAACTCCGGAAAATACATCTTTATACTCTTTTGAT
>LE_HBa0051K05_SP6_11624 (trimmed for quality and cloning vector)
AAGACAACTGAATTCTTTGCACTTTCCTGCTAGATTCGAGATGAATCTCCTAAGATATGCTAGCTTCCATTGCAGACTCTTCAATTCATGGATGTTTCTT
GGCTCGACCATCTTTCAAATTGCATTTATTTTTGCTTGATCATTTTTTATTCCTCGATGTCGTACAAGGAAACCAAGGAATTTTCTACACCATCCTCAAG
TCTTTCAAGTGGTCACAATTTTTTCTTGATTTCACTTCTAACTCATCAACATAATATTCAACATTTTTGTGAAGAATTATATCTAAGATGTTCTGTATAG
ATCTTTAGTATGTTGCTCTTGCATTCTTTACAAAAGGTATTACTTTGTAGCAATAAATGCCATTTGGAGTCCACAAGGCGGTCAACTCTTCATCCTTTGG
TGACATGCAAATCTGGTTGTAGCCGGATGAAGCGTCCATAAAAGACATCGCCTCATACCCAATAGTGCCATCAATCATAAGCTTAGGGATAGGAAGTGGA
ACTTCATATTTCGGATATGCATTATTGAGATCCCTTAAGTCAATACAAACTCAAATTTTCCCATTCTTCTTCTTCACGGGGATAATACTTGAAACCCATA
TGGGTACTTAACTTCATGAATAAAGCTAACCTCAATAAGCTTGTTAACTTCAGTTTCTACCACAGGAACCAATCCAGTCCTAAAATGCCGTTGAGCTTGC
TTGATGGGACGTGTACCACTTTTCACAACAAGATGATGGACTGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964039
Expected error %
0.0353664
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ82037.1| Score 121 E Value 1e-37 Identity 47.60% Align. Length 725bp (97.45%) Frame 2
gag/pol polyprotein [Pisum sativum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 121 E Value 1e-36 Identity 45.20% Align. Length 725bp (97.45%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0051K05
Clone
Clone name
hba-51k5
LE_HBa0051K05
P051K05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found