Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0051M12_T7_11735

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0051M12_T7_11735
Primer
T7
ID from Seq. Facility
LE_HBa_051_M12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
757 trimmed for vector and quality, 921 raw
Genbank Accession
Sequence
>LE_HBa0051M12_T7_11735 (raw untrimmed)
AATAACTCGGGTACCGGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATATATCTCTGGTTGTGTTGTCTTGCTTTATATTAATTTAAAGTTA
TTCATAAGCTGAGCATCCTCAAAGTAAGTGTTCCTTCTTACTCTTTTCAAAATTAGGTGTTGGTTTAGCATTCCAACTGGCATACTCATACATTCAATGT
ATTGATGCCAGTTGGCCTGCATTGTCTTATAATTTATATGCAAGTAACTATGATCTTCATCCGGTGTATCGTCAATCCATTAAAAATATTATAGTCAATT
GTTGAGCCTCCTTATATTTTGGAGGACATGTTTTATCACTTGATTTTACGTTTTTAGTTGTTAGGATGACTGGGGGTCCTTTCCTAACATCGCTCTTTGT
TTTATAGGCTTCATATACAAACAACATGGTTCTTTAGTCTTATTATTTATGTTGTAAACGTTGAAGACCTGAGTTTCCACTTTGGATAAGTATTACTTTT
AAGTTAATTGTTGAGTTATATCTTGTGTTTAAATCTTTTAGTGATTAAATAAACTATACCAAGGTTCTGCTCGAGGCCATCTATGGTCTTCTAGTGCCAG
CCACGTCCAATGTGTACGCTCGAGGTGTGACATATATATAGTATAATTTTCTGAGGAAGGGTATCCAATTGGACACCGATAAATAAGTTATGACCATGGT
TAATGATTTCCTATAAATCTGACTGAACTTTTGATTTGTGTAGTATATAATTACATATATATAAACATAAATTGTATAATATTTTAATAGATCAAGACTT
GAAATATACTATTAATATGTACTCTATTAATTGTAATTAGTTTCATCAATTAATCCCAAATTTCATAAACAACGCACTCGCTCGTATTTTATGAGTAAAA
TCATGATTTCAAAAATGATTG
>LE_HBa0051M12_T7_11735 (trimmed for quality and cloning vector)
AGCTTTATATATCTCTGGTTGTGTTGTCTTGCTTTATATTAATTTAAAGTTATTCATAAGCTGAGCATCCTCAAAGTAAGTGTTCCTTCTTACTCTTTTC
AAAATTAGGTGTTGGTTTAGCATTCCAACTGGCATACTCATACATTCAATGTATTGATGCCAGTTGGCCTGCATTGTCTTATAATTTATATGCAAGTAAC
TATGATCTTCATCCGGTGTATCGTCAATCCATTAAAAATATTATAGTCAATTGTTGAGCCTCCTTATATTTTGGAGGACATGTTTTATCACTTGATTTTA
CGTTTTTAGTTGTTAGGATGACTGGGGGTCCTTTCCTAACATCGCTCTTTGTTTTATAGGCTTCATATACAAACAACATGGTTCTTTAGTCTTATTATTT
ATGTTGTAAACGTTGAAGACCTGAGTTTCCACTTTGGATAAGTATTACTTTTAAGTTAATTGTTGAGTTATATCTTGTGTTTAAATCTTTTAGTGATTAA
ATAAACTATACCAAGGTTCTGCTCGAGGCCATCTATGGTCTTCTAGTGCCAGCCACGTCCAATGTGTACGCTCGAGGTGTGACATATATATAGTATAATT
TTCTGAGGAAGGGTATCCAATTGGACACCGATAAATAAGTTATGACCATGGTTAATGATTTCCTATAAATCTGACTGAACTTTTGATTTGTGTAGTATAT
AATTACATATATATAAACATAAATTGTATAATATTTTAATAGATCAAGACTTGAAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.940049
Expected error %
2.91598
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38795.1| Score 80 E Value 6e-14 Identity 15.10% Align. Length 317bp (41.88%) Frame 2
hypothetical protein PGEC747E24.3 [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38798.1| Score 78 E Value 2e-13 Identity 13.90% Align. Length 293bp (38.71%) Frame 2
hypothetical protein PGEC747E24.8 [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0051M12
Clone
Clone name
hba-51m12
LE_HBa0051M12
C08HBa0051M12
P051M12
Clone type
BAC
Contamination
none
Estimated length
109,799
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found