Clone Read LE_HBa0004J02_T7_1203

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004J02_T7_1203
Primer
T7
ID from Seq. Facility
LE_Hba_004_J02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
803 trimmed for vector and quality, 1134 raw
Genbank Accession
Sequence
>LE_HBa0004J02_T7_1203 (raw untrimmed)
GGTGACTCGGGCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCAAGAATGCCCTAAGCAATCCCCAATTGAAGATTTGTCACTGACAA
ATTACAGTAAAATACAACTTATATACCCCAACCCTCGGAAGTTTTCAGTTACGTAAGCACAGTTGTGTATACCTTCCTACCTTTCAATTATTTAAATATT
TCATAATACCACATCTGATAGCAAGTATCTTAAAAACAATAGCATTGACCAACTTGACAATTATCTATTTTTGCAGAAAATTAAAAGTAAAGAACCATAA
GTGCTAATGACTAAATTATGTTATCTATAATAATCTGAAGCTAAATTTAAAAGATAACAAAGAAAAAGTCAAGGGGAAAGAGAAGAGTATGCACATTCCT
CCTTTTAACCAAATGTTTCAAGTTTGACAGATCTATCAATAATTAGAAGAAAAACATGAACTGACAAGGAAAACGGTTACCTCCCCTTCTTCAATATTAT
TTGCTTTCTGCTTTAACTGCAGAATGGATATTTCAATCTTTGCCATCAAATACTGGCTAGATTGTTGCAATCGCTCCTTGAATTGAACAAACTCAATAAC
CTAAAAAAGTTCACAGATGAAGATTTTGTTACCATTGGGCTAGCTCATTGTATGATTACTAATTTATCTTTTCGTTCACAAAGGGAACCATTAGTATTTG
AAATGATCCTAAGAGAGAATCGTCATGATAAGCAACGTAAATTTCTACACCAGAAAATAAATAATTGCTCCAACAAATACTCACTCAAGAACTACTTCGC
AAGAACTAAGTTACCCAGAAACAGTTAAAAAGTTCTTCCTGTTAGCCTCTTTCCTCACCTGCTATAACAAAAGAGGTTTACCAACAGTGGGGAAAAAGCA
ATTACCAAACCACGTTTACGCAAAATTCGCCTCGAACCTCTAAAAAGAACTAAACCTTAATTTATATTTATTTTTCTTTGGAAGAAGGGTTTAGAACTTT
AAAATTAAAGGTAAAAAAATTCTGGAATATTTTTGGAAAAAGGAATGTCGAAAATTAACTGACATAATTTTTTTACTTCAGCGGGCTTACCTTCGGGGAA
AAAAAAATTCTCTATAATTGAGAAGGGTCTCCAC
>LE_HBa0004J02_T7_1203 (trimmed for quality and cloning vector)
AGCTTTCAAGAATGCCCTAAGCAATCCCCAATTGAAGATTTGTCACTGACAAATTACAGTAAAATACAACTTATATACCCCAACCCTCGGAAGTTTTCAG
TTACGTAAGCACAGTTGTGTATACCTTCCTACCTTTCAATTATTTAAATATTTCATAATACCACATCTGATAGCAAGTATCTTAAAAACAATAGCATTGA
CCAACTTGACAATTATCTATTTTTGCAGAAAATTAAAAGTAAAGAACCATAAGTGCTAATGACTAAATTATGTTATCTATAATAATCTGAAGCTAAATTT
AAAAGATAACAAAGAAAAAGTCAAGGGGAAAGAGAAGAGTATGCACATTCCTCCTTTTAACCAAATGTTTCAAGTTTGACAGATCTATCAATAATTAGAA
GAAAAACATGAACTGACAAGGAAAACGGTTACCTCCCCTTCTTCAATATTATTTGCTTTCTGCTTTAACTGCAGAATGGATATTTCAATCTTTGCCATCA
AATACTGGCTAGATTGTTGCAATCGCTCCTTGAATTGAACAAACTCAATAACCTAAAAAAGTTCACAGATGAAGATTTTGTTACCATTGGGCTAGCTCAT
TGTATGATTACTAATTTATCTTTTCGTTCACAAAGGGAACCATTAGTATTTGAAATGATCCTAAGAGAGAATCGTCATGATAAGCAACGTAAATTTCTAC
ACCAGAAAATAAATAATTGCTCCAACAAATACTCACTCAAGAACTACTTCGCAAGAACTAAGTTACCCAGAAACAGTTAAAAAGTTCTTCCTGTTAGCCT
CTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.932366
Expected error %
0.956231
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004J02
Clone
Clone name
hba-4j2
LE_HBa0004J02
C12HBa0004J02
P004J02
Clone type
BAC
Contamination
none
Estimated length
104,233
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found