Clone Read LE_HBa0011D23_SP6_121045

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011D23_SP6_121045
Primer
SP6
ID from Seq. Facility
LE_HBa_011_D23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
684 trimmed for vector and quality, 908 raw
Genbank Accession
Sequence
>LE_HBa0011D23_SP6_121045 (raw untrimmed)
AAAAAAAAAATTGGTCTTCNCCCCTAGTGACNNANNNNNNNNNNNNNNNNNGNNNNNNGNGNNANACNNCNNNNNCNGNANACANGCCNANGCNNNGNNG
CGGNTCTTCCACGTNTCNTCAN
TACGTAATGCCACTTCAATGTTGTAACCAAAAACATGATCATATATTCTCCTCCCATATTGCTCAACATCTTCAGCGG
CTCTACGTTCAAAAACATCCTCTGAATGTTCTGATGAACTCGAAGCATCAGTAGAACGCACATTAAGGTCATTTTCCTGATTCTTGTTCCCAAAAAGCTT
TGCAAACAGCAGATCTTTTGCCCATACGATGCAGTGAACAAACTAAAGCAGATAACAATTCAAAGCAAAATATTAGGCAAAAACGCTTGAGATTGTGAGA
GAGTCAGTACCGGAATGATATTTAATTAAACACAGATATACAGATTGGCTCAGCTCAAATTTACATTAAGAAAAAAAAAGGATTAAGGACGTGTCAGTAC
CTTTGTTGGAGTGCTTGTGATTGTACAGACAGGGTAAGTTTTTGGAGCTGGTTTAGATTGACATTCATAGCATTCTGTTTTACCTTTCACATGTACCGTG
ACCTGCCACAAAAAAAGATACGATGATGAGAATCACAGAACTAGTAAGAGTCAACAAGGATATTCTGTCAGTTGATAAACAGAAACAGCAGAACACAGTA
ATACACTATGGACCAAAATCCAAAAAAAGAGCAGCCAAACAAGAACGTTTGACCTTAAAAACACATATAAAGCTACAGGACTATGTATTTCCGCTATGAT
CTTTGAGGGTGCATAAATAGGTTGACCTATTGGCTAAAAGTTTGATCAAACAAAAAGCTGAAAATGCTCCATCCTTCAAAAAATGAGGTGATGAGAACTT
GTAGCATG
>LE_HBa0011D23_SP6_121045 (trimmed for quality and cloning vector)
TACGTAATGCCACTTCAATGTTGTAACCAAAAACATGATCATATATTCTCCTCCCATATTGCTCAACATCTTCAGCGGCTCTACGTTCAAAAACATCCTC
TGAATGTTCTGATGAACTCGAAGCATCAGTAGAACGCACATTAAGGTCATTTTCCTGATTCTTGTTCCCAAAAAGCTTTGCAAACAGCAGATCTTTTGCC
CATACGATGCAGTGAACAAACTAAAGCAGATAACAATTCAAAGCAAAATATTAGGCAAAAACGCTTGAGATTGTGAGAGAGTCAGTACCGGAATGATATT
TAATTAAACACAGATATACAGATTGGCTCAGCTCAAATTTACATTAAGAAAAAAAAAGGATTAAGGACGTGTCAGTACCTTTGTTGGAGTGCTTGTGATT
GTACAGACAGGGTAAGTTTTTGGAGCTGGTTTAGATTGACATTCATAGCATTCTGTTTTACCTTTCACATGTACCGTGACCTGCCACAAAAAAAGATACG
ATGATGAGAATCACAGAACTAGTAAGAGTCAACAAGGATATTCTGTCAGTTGATAAACAGAAACAGCAGAACACAGTAATACACTATGGACCAAAATCCA
AAAAAAGAGCAGCCAAACAAGAACGTTTGACCTTAAAAACACATATAAAGCTACAGGACTATGTATTTCCGCTATGATCTTTGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958212
Expected error %
0.1754
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g21470.1 Score 112 E Value 1e-25 Identity 73.60% Align. Length 478bp (69.88%) Frame 3
68415.m02554 SUMO activating enzyme 2 (SAE2) nearly identical to SUMO activating enzyme 2 [Arabidopsis thaliana] GI:22652854; contains Pfam profiles PF00899: ThiF family, PF02134: Repeat in ubiquitin-activating (UBA) protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g21470.2 Score 112 E Value 1e-25 Identity 73.60% Align. Length 478bp (69.88%) Frame 3
68415.m02555 SUMO activating enzyme 2 (SAE2) nearly identical to SUMO activating enzyme 2 [Arabidopsis thaliana] GI:22652854; contains Pfam profiles PF00899: ThiF family, PF02134: Repeat in ubiquitin-activating (UBA) protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD23691.1| Score 112 E Value 7e-24 Identity 73.60% Align. Length 478bp (69.88%) Frame 3
putative ubiquitin activating enzyme [Arabidopsis thaliana] pir||F84601 probable ubiquitin activating enzyme [imported] - Arabidopsis thaliana ref|NP_973506.1| SUMO activating enzyme 2 (SAE2) [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN03851.1| Score 112 E Value 7e-24 Identity 73.60% Align. Length 478bp (69.88%) Frame 3
SUMO activating enzyme 2 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011D23
Clone
Clone name
hba-11d23
LE_HBa0011D23
P011D23
Clone type
BAC
Contamination
none
Estimated length
90,601
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found