Clone Read LE_HBa0011F13_SP6_121083

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011F13_SP6_121083
Primer
SP6
ID from Seq. Facility
LE_HBa_011_F13-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
741 trimmed for vector and quality, 990 raw
Genbank Accession
Sequence
>LE_HBa0011F13_SP6_121083 (raw untrimmed)
AAAAAAAAAGTGGTTTTCCNCAGCATATGTGAGANNNNNNNNNNCNNATTTNANATCCAAAGCAANCAACTGCANAAAAGGAAATCATTATGAGGCGTAG
CCGACAACCTCCAAGACACAAAAAGTTAACGTTGGCAATAACAAACTGCTTAGATTATGTCCAAGTATATGAATGTGGTGCATGTGACCGGGATTCAAAT
AATTCATGAATCTGCTGAGCCTTGCACCAATTATCCCAAACTTTTAAGCCTCTCAGGTTAATTATGGAAGCAAAGAAGGTCAGAGCAATACCAGTTTGCT
GCTTCAGTTCCTTCAGTGGATCTAATTCTGCTATGTTATGTAACTAACAATTTCTTATTCATAAAACCTATTCAACCACGGGTGTATAGTGAATAGTCTA
TCATGAATACATCAATCCTGGAAATAGACAGTTAAATTTTGAGTAGTGACTTCATCATTTGCATGCATAGTATCTTTCCTTGGAAGAATACACAGTCACT
AAGAGTCTTACTTAGTAGGGCTTGTAATCACTACAATAATAAAACAGTTGCATGATAGAAAATAACACGGCAAGTAGAGACCACCTGTTGAAACAAGGAG
GGATTCAAATTGACATCATATTCAATATGGCGATCATCCAACCCACTGCTGAATGCTTTACTGTCTGGGAGTTTCCATCTCCACAAATCTCTGTCCTCTA
TATATTCGAATAATCTCCTGACTCTGTCAAATTCACCAATCTTTACTGCATTGCCGTCAGCAGCTTCATTATTGTTTCCGGTTATGAGCTTCTCTTTGAA
ATAATCATAAGAAATAAGTAGCCCCCCTTCTATCCATGTCCATTCCTTTGCTCACTTTTTCAGTCCCAGATGTCCCTCCCCCTAACACTCTTTGCAGTCT
TGGAATGGCCAATACAACACCCTTGAGATAAATCCCCAAAAGATAAATTCATGAATTAAAGGCCCAAGATTAGGTTTATTAATTCTTGAC
>LE_HBa0011F13_SP6_121083 (trimmed for quality and cloning vector)
AAATCATTATGAGGCGTAGCCGACAACCTCCAAGACACAAAAAGTTAACGTTGGCAATAACAAACTGCTTAGATTATGTCCAAGTATATGAATGTGGTGC
ATGTGACCGGGATTCAAATAATTCATGAATCTGCTGAGCCTTGCACCAATTATCCCAAACTTTTAAGCCTCTCAGGTTAATTATGGAAGCAAAGAAGGTC
AGAGCAATACCAGTTTGCTGCTTCAGTTCCTTCAGTGGATCTAATTCTGCTATGTTATGTAACTAACAATTTCTTATTCATAAAACCTATTCAACCACGG
GTGTATAGTGAATAGTCTATCATGAATACATCAATCCTGGAAATAGACAGTTAAATTTTGAGTAGTGACTTCATCATTTGCATGCATAGTATCTTTCCTT
GGAAGAATACACAGTCACTAAGAGTCTTACTTAGTAGGGCTTGTAATCACTACAATAATAAAACAGTTGCATGATAGAAAATAACACGGCAAGTAGAGAC
CACCTGTTGAAACAAGGAGGGATTCAAATTGACATCATATTCAATATGGCGATCATCCAACCCACTGCTGAATGCTTTACTGTCTGGGAGTTTCCATCTC
CACAAATCTCTGTCCTCTATATATTCGAATAATCTCCTGACTCTGTCAAATTCACCAATCTTTACTGCATTGCCGTCAGCAGCTTCATTATTGTTTCCGG
TTATGAGCTTCTCTTTGAAATAATCATAAGAAATAAGTAGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.96289
Expected error %
0.2164
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53345.1 Score 90 E Value 1e-18 Identity 17.10% Align. Length 239bp (32.25%) Frame 1
68414.m06047 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_564629.1| Score 90 E Value 5e-17 Identity 17.10% Align. Length 239bp (32.25%) Frame 1
expressed protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF69538.1| Score 90 E Value 5e-17 Identity 17.10% Align. Length 239bp (32.25%) Frame 1
F12M16.25 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011F13
Clone
Clone name
hba-11f13
LE_HBa0011F13
P011F13
Clone type
BAC
Contamination
none
Estimated length
88,411
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found