Clone Read LE_HBa0011L11_SP6_121225

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0011L11_SP6_121225
Primer
SP6
ID from Seq. Facility
LE_HBa_011_L11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
737 trimmed for vector and quality, 990 raw
Genbank Accession
Sequence
>LE_HBa0011L11_SP6_121225 (raw untrimmed)
AAAAAATTAATGGTTCTCTCCGGCTATGTGACANGNNNNNNNNANNNNAANGCNANGACTANGAACTATGACTATTCNAAGCANAAATCGGATGGTGAAA
ATCACTTGCAGAGTCACCAGAAGTTTTCAGCTCCAACCCCTTTGTTAGCTAGTGTTCCATCCTCCAAGAATAGGTAAGACTAGAAGGGTAGAGCACCAGG
CTCTAATTCTCGGGAAGTGTTTTAGGCACCAAGACTTACCCCACTTACCCTAAGTGTGGTAAGAACTATCCAGACGGGTGTCTCGCCCCTAACTTAGAGT
TGACATTTAAATCGAGAATCAACATCAGGTCCCAGTTATCCACACGAAAAGAAGGATGTTTTAGGTGCGGTCAGTACTTTCAAATGTTAAGGGATTGTCC
TTGTATACAGGTTCAAGGAGGTGATAACGGTAAATCTTAGTTTGTAACTTCATTAGCACTAGCAAGTCGCCCGACTCAGCTCGGTAATTCATCTGGTATA
GGTGGCAGTCAGTGCCAGAACAAGTTGTATGCTCTTCATGCTCGCCAGGATCAGGAAGGTTCTCCTGATGTAGTCACTGGTACATTACGTGTCTTTGACC
TTGATGTTTTTTGCATTGTTAGATCTATGGTTTACTCTTTCTTTTGTCCTCACATAGCAGTCCAATTCAGTGTTAGTCCAAAAACTCTCTCAGAACCTTT
CATAGTCTCTACTCCAGTCGGTGACCTAGTTATAGGTAGATGGGTATACAGAAATCGACCTGTCTGAGTCTCTCAAAAAGTCACCTAAGAAGATCTTGTA
GAGTTAGAAATGGTAGACTTTGATGTCATTCTAAGCATGGATTGGTTACATTCTTGTTATGTGTCAGTCGATTATAGAACAGGATTGTTCGTTTTCATTT
CAGGGTGAGTCAATCAAAAATGGAGGGGAGTAGTTTAGCCCCATGGGTGAATTATTCTTACCTTTCGGCCTAAAAATAATCCCTAGGGTT
>LE_HBa0011L11_SP6_121225 (trimmed for quality and cloning vector)
GAACTATGACTATTCNAAGCANAAATCGGATGGTGAAAATCACTTGCAGAGTCACCAGAAGTTTTCAGCTCCAACCCCTTTGTTAGCTAGTGTTCCATCC
TCCAAGAATAGGTAAGACTAGAAGGGTAGAGCACCAGGCTCTAATTCTCGGGAAGTGTTTTAGGCACCAAGACTTACCCCACTTACCCTAAGTGTGGTAA
GAACTATCCAGACGGGTGTCTCGCCCCTAACTTAGAGTTGACATTTAAATCGAGAATCAACATCAGGTCCCAGTTATCCACACGAAAAGAAGGATGTTTT
AGGTGCGGTCAGTACTTTCAAATGTTAAGGGATTGTCCTTGTATACAGGTTCAAGGAGGTGATAACGGTAAATCTTAGTTTGTAACTTCATTAGCACTAG
CAAGTCGCCCGACTCAGCTCGGTAATTCATCTGGTATAGGTGGCAGTCAGTGCCAGAACAAGTTGTATGCTCTTCATGCTCGCCAGGATCAGGAAGGTTC
TCCTGATGTAGTCACTGGTACATTACGTGTCTTTGACCTTGATGTTTTTTGCATTGTTAGATCTATGGTTTACTCTTTCTTTTGTCCTCACATAGCAGTC
CAATTCAGTGTTAGTCCAAAAACTCTCTCAGAACCTTTCATAGTCTCTACTCCAGTCGGTGACCTAGTTATAGGTAGATGGGTATACAGAAATCGACCTG
TCTGAGTCTCTCAAAAAGTCACCTAAGAAGATCTTGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.983604
Expected error %
0.7102
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31186.1| Score 112 E Value 8e-24 Identity 12.20% Align. Length 557bp (75.58%) Frame 2
putative gag-pol polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 110 E Value 3e-23 Identity 12.10% Align. Length 587bp (79.65%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0011L11
Clone
Clone name
hba-11l11
LE_HBa0011L11
P011L11
Clone type
BAC
Contamination
none
Estimated length
141,092
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found