Clone Read LE_HBa0045J15_T7_121565

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0045J15_T7_121565
Primer
T7
ID from Seq. Facility
LE_HBa_045_J15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
626 trimmed for vector and quality, 943 raw
Genbank Accession
Sequence
>LE_HBa0045J15_T7_121565 (raw untrimmed)
CCCGTGGGGGGATCCTCTTAGAGTCGACCTTGCAGGCATGCAAGCTTGTGCCAACAAGAAGCAGCATAAGCATGATTCAGCACACCGCAGCTTGGGAAAT
GAACAAGAGCTTGGCAAGCACCGTGAGGTTTCACCCAGGGTAAGAAATGTTTTTTTAACTTATAAGATACAAGACAAACTTCTCTTCAGCTGTACAATAG
AAAATGTATTTGGTACAGTAAATAACATGATTACTACCCCCTATTCTGCATGTCGTTAGACAATTTAGAGCATGAATAGTAATGCCGTTCACTTAGGGGA
GCAAATGACCTTAGGGGTTTCAACATTGTTCCTACTTTCTCCCTACACGACTTGAAAGGCTCGACCAACCAGTTATAGGAGGAGATGCTTAACCAGTAAA
AGATAACAAAATTTTCTAGCATTTAAAGGGGTCCTCCATATGAAACAAGTAGGAAAATAGTAAAGGTAAGAAAGTGATAGTATGGTTTTGCTTGAGAACA
AAAGACTGAAAATCCTTCAAATCTTTTTCAGATAGGTATACATGAGAACAATAGGTTCTGTCAGCAGTCTAAAAATATAGATTACTGTTTAAAACCTTCT
CAAAATAGATTGTCTAAACCCATCTTCCCAACCGAGATAGGAGTGTCTACTGGGGGTTGGGAAAGGTTATGAAGTTGTTTCTAAGTATCTTGTATTAAGA
TTTAACTTATTCTACTTGTGCATTTAGTGAAATTTTTTTCTAATTTTGGTCTTAAGATTTCTTATTGCCCCTATAATTAGGTAGGAAATGTTCATAACTC
CGCCAAAAAACACATACTTAGATGTAGGGTATGATGAAGTCTGATATCACGAGGAAGATGTATAGAATGGTGCAATTAAATAGTAATTTTTCATATTAAA
ACTATGTTACTAATAAAGGGTGGAATAGTTTCACGATATGATT
>LE_HBa0045J15_T7_121565 (trimmed for quality and cloning vector)
GGCATGCAAGCTTGTGCCAACAAGAAGCAGCATAAGCATGATTCAGCACACCGCAGCTTGGGAAATGAACAAGAGCTTGGCAAGCACCGTGAGGTTTCAC
CCAGGGTAAGAAATGTTTTTTTAACTTATAAGATACAAGACAAACTTCTCTTCAGCTGTACAATAGAAAATGTATTTGGTACAGTAAATAACATGATTAC
TACCCCCTATTCTGCATGTCGTTAGACAATTTAGAGCATGAATAGTAATGCCGTTCACTTAGGGGAGCAAATGACCTTAGGGGTTTCAACATTGTTCCTA
CTTTCTCCCTACACGACTTGAAAGGCTCGACCAACCAGTTATAGGAGGAGATGCTTAACCAGTAAAAGATAACAAAATTTTCTAGCATTTAAAGGGGTCC
TCCATATGAAACAAGTAGGAAAATAGTAAAGGTAAGAAAGTGATAGTATGGTTTTGCTTGAGAACAAAAGACTGAAAATCCTTCAAATCTTTTTCAGATA
GGTATACATGAGAACAATAGGTTCTGTCAGCAGTCTAAAAATATAGATTACTGTTTAAAACCTTCTCAAAATAGATTGTCTAAACCCATCTTCCCAACCG
AGATAGGAGTGTCTACTGGGGGTTGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95377
Expected error %
0.1228
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0045J15
Clone
Clone name
hba-45j15
LE_HBa0045J15
P045J15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found