Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0045L17_T7_121615

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0045L17_T7_121615
Primer
T7
ID from Seq. Facility
LE_HBa_045_L17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
600 trimmed for vector and quality, 910 raw
Genbank Accession
Sequence
>LE_HBa0045L17_T7_121615 (raw untrimmed)
CGAACCTGGGACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTTCTCTCTCAACATTTCCACTTTCATTCTCAAGTGCTCCTCATGTTC
TTTCTTGCTCTTTGAGTATACCAGTATATCATCAATGAATACGATGACAAAGAGATCCAGATATGGCTTAAAAATCCCGTTCATCAAGCTTATGAAAGCA
GCAGGGGCATTCGTAAGCCCAAAAGACATTACTAAGAACTCATAATGTCCATACCTAGTCCGAAAAGCAGTCTTGGGCACATCCGTTGCCCGTATTTTCA
ATTGATACTATCCTGCTGACACACGATCCATTAATACTATCCTGGTGTCGAAACGTGACACCCGATCCATTAATACTATCCTGGTGTCGGAACGTGACAC
CCGGTCCACTAATACTATCCTGGTGTCGGAACGTGACACCCGATCCACTAATACTATCCTAGTGTCGAAACGTGATACCCGATCCACTAATACTATCCTG
GTGTCAGAACGTGACACCCGATCTACTAACCTCATTCTTTTAGGTCATCAAGTCTTCTTTTATACCAAGGCATCATCATTAACAAAGAGGTTTCAAGGTT
TAAGATTCAACAGCCTCATCATGCTTATTTTTATTACAATTACATAATCCCATCATACAAGCATACAATTAAGCATATAGCATATTTTACAATACTAGAC
AATACATATCAGTGATTAGAGGAAGGTTATATGAAATAACATAGGATGATAATCCTACTTCCGCCGAAGAATTCGTATCATAAGGTCAAACTTTCCATAC
TTTGGTTGTATTTCGTAACTACATGGACCGGTCCGGGAGGTACACCGCCTAATACCATCAGGCAGCGATAGGAACCCTGTGTATTTTCTGATGCACTGTT
AATATACAAA
>LE_HBa0045L17_T7_121615 (trimmed for quality and cloning vector)
AGCTTTTTCTCTCTCAACATTTCCACTTTCATTCTCAAGTGCTCCTCATGTTCTTTCTTGCTCTTTGAGTATACCAGTATATCATCAATGAATACGATGA
CAAAGAGATCCAGATATGGCTTAAAAATCCCGTTCATCAAGCTTATGAAAGCAGCAGGGGCATTCGTAAGCCCAAAAGACATTACTAAGAACTCATAATG
TCCATACCTAGTCCGAAAAGCAGTCTTGGGCACATCCGTTGCCCGTATTTTCAATTGATACTATCCTGCTGACACACGATCCATTAATACTATCCTGGTG
TCGAAACGTGACACCCGATCCATTAATACTATCCTGGTGTCGGAACGTGACACCCGGTCCACTAATACTATCCTGGTGTCGGAACGTGACACCCGATCCA
CTAATACTATCCTAGTGTCGAAACGTGATACCCGATCCACTAATACTATCCTGGTGTCAGAACGTGACACCCGATCTACTAACCTCATTCTTTTAGGTCA
TCAAGTCTTCTTTTATACCAAGGCATCATCATTAACAAAGAGGTTTCAAGGTTTAAGATTCAACAGCCTCATCATGCTTATTTTTATTACAATTACATAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.975309
Expected error %
0.3013
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39297.1| Score 134 E Value 1e-30 Identity 22.80% Align. Length 266bp (44.33%) Frame 1
putative gag-pol protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP53268.1| Score 134 E Value 1e-30 Identity 22.30% Align. Length 272bp (45.33%) Frame 1
putative 22 kDa kafirin cluster; Ty3-Gypsy type [Oryza sativa (japonica cultivar-group)] ref|NP_920981.1| putative 22 kDa kafirin cluster; Ty3-Gypsy type [Oryza sativa (japonica cultivar-group)] gb|AAM48279.1| Putative 22 kDa kafirin cluster; Ty3-Gypsy type [Oryza sativa (japonica cultivar-group)] gb|AAL79340.1| Putative 22 kDa kafirin cluster; Ty3-Gypsy type [Oryza sativa]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0045L17
Clone
Clone name
hba-45l17
LE_HBa0045L17
C03HBa0045L17
P045L17
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found