Clone Read LE_HBa0107H12_T7_121898

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0107H12_T7_121898
Primer
T7
ID from Seq. Facility
LE_HBa_107_H12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
413 trimmed for vector and quality, 736 raw
Genbank Accession
Sequence
>LE_HBa0107H12_T7_121898 (raw untrimmed)
TGTTGTGTTTTAACGACACTTTGAAAGTCCATTCATTTAGACTTATATTAATGCGTCAGCTTGCAGATTCAGCCGATGAGATTAAGATACAGATAGTAGA
TTTCACAGGAGAGGACAGACTTCATGTCCATATATCATCTATGTATCTTCCCTCAGATGACGAAGAAGAGGTAATCAATTTCTTACATCGTCACCCATAC
CTAGTTCAGTTTTTACTAATTAATTAGTATAAGCACTTTCTGTTGGATAGCAATTAAAGGCTGAAATACTGAAATAGAAAAACGTTACAAGAAAGGCCTC
AGTTGAACACGCTTTATACCTGGCATCATTTGTGGAATTTTGCATCCTACACTAACTAGTTTTTTTTCCTCTGTAATTCTGGAGATGTTTTAAATTAATG
TTTTGAGTGTTTTCTTTCGTGTTAACTGTGTATTGCTTCGCCTCATTAGTAATTGTTTTATTTGCAGTGAAGCCTGGAAATTTAGGCATTGCAGATGGCT
TGTAGGACATGAAGGCGGTACACAAGGCGAGGTGATTTGAACTTGGTTTAGAGATTATTGGGATAATGTCATCATCCTGCCTTATGGCTATGTTTAGAAA
TTGTTCTACAGTCTTAGCCTTGTTTGATTTACTTTTCATTCTCAATCTTCGCTATTTGTGTCTTTTTAATCTCCTTTTTTGATGTATGTATTTTGTCTTC
TATTTCTCTCTTTTTTCCTTTTTTTTTTTTTTTTTT
>LE_HBa0107H12_T7_121898 (trimmed for quality and cloning vector)
AGCTTGCAGATTCAGCCGATGAGATTAAGATACAGATAGTAGATTTCACAGGAGAGGACAGACTTCATGTCCATATATCATCTATGTATCTTCCCTCAGA
TGACGAAGAAGAGGTAATCAATTTCTTACATCGTCACCCATACCTAGTTCAGTTTTTACTAATTAATTAGTATAAGCACTTTCTGTTGGATAGCAATTAA
AGGCTGAAATACTGAAATAGAAAAACGTTACAAGAAAGGCCTCAGTTGAACACGCTTTATACCTGGCATCATTTGTGGAATTTTGCATCCTACACTAACT
AGTTTTTTTTCCTCTGTAATTCTGGAGATGTTTTAAATTAATGTTTTGAGTGTTTTCTTTCGTGTTAACTGTGTATTGCTTCGCCTCATTAGTAATTGTT
TTATTTGCAGTGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945023
Expected error %
0.7235
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD29726.1| Score 77 E Value 1e-13 Identity 33.30% Align. Length 110bp (26.63%) Frame 1
hero resistance protein 2 homologue [Lycopersicon esculentum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0107H12
Clone
Clone name
hba-107h12
LE_HBa0107H12
C02HBa0107H12
P107H12
Clone type
BAC
Contamination
none
Estimated length
110,622
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found