Clone Read LE_HBa0107K14_T7_121972

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0107K14_T7_121972
Primer
T7
ID from Seq. Facility
LE_HBa_107_K14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
628 trimmed for vector and quality, 829 raw
Genbank Accession
Sequence
>LE_HBa0107K14_T7_121972 (raw untrimmed)
TCGGTACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATCACACATCAGTTGCAATCAAACTGTATAGTTCTGCTGATGTTGATTCTG
AAGACACCTTTCAAGCTAAGGTAATTCAACACACTTTATTTGCAGTTAAATCGGTAGAATTTCATGTATCAAAATACTTTAGATGGAAAAAAATCGAAAT
ATCCTCTGTTGTACTTGGGGGAAAATACGAGATGATATGCTAATGGCAAAGGTATGAGTAGCTCTAAATTAACGATATCATGAAAATAGTAACATGACAT
GTCTGAAATCCGAAAAATTCTGATGCAGGTGAAGTTCTTAAGTAATATGAGGCATCCTCATATGCTATCGATGATCGGATATTGCTCTGAGCTAAGGTGC
ATCGTGTTCGAGTATATGCACAATGGTTGCTTAAGAGACATTCTCTTCTCAGGCACCAGAGGCTCTAAAAGGAGGAATAAGGGCCTAAACTGGCAAGCTA
GGATATGTATTGTAGCCAATGTCTGTACTGGCTTGTGCTTCCTCCATCATGCCAAGCCAACGCCCGTGGCTCATGGCAACCTGAACCCTTCAAAAATCCT
TCTTGATTATAACTATATGGCGAAAATCCATGGTGTTAGGACACCTTCTGTCATGTGGACAGATCGAATATGAAATTCGATATCCGGGCTTATGGGAACT
TAGTCTTCCAGATTTCTGAATGGAATAAACTGGGCGGGGTTGGTTGAGGATGTTATTTTGATTGACAAAAATTAGCCCTATTGTAGTTTTTTTATCTTAT
GGTTTCAAATGTTGTCTTTTGTTTTTTTT
>LE_HBa0107K14_T7_121972 (trimmed for quality and cloning vector)
AGCTTCATCACACATCAGTTGCAATCAAACTGTATAGTTCTGCTGATGTTGATTCTGAAGACACCTTTCAAGCTAAGGTAATTCAACACACTTTATTTGC
AGTTAAATCGGTAGAATTTCATGTATCAAAATACTTTAGATGGAAAAAAATCGAAATATCCTCTGTTGTACTTGGGGGAAAATACGAGATGATATGCTAA
TGGCAAAGGTATGAGTAGCTCTAAATTAACGATATCATGAAAATAGTAACATGACATGTCTGAAATCCGAAAAATTCTGATGCAGGTGAAGTTCTTAAGT
AATATGAGGCATCCTCATATGCTATCGATGATCGGATATTGCTCTGAGCTAAGGTGCATCGTGTTCGAGTATATGCACAATGGTTGCTTAAGAGACATTC
TCTTCTCAGGCACCAGAGGCTCTAAAAGGAGGAATAAGGGCCTAAACTGGCAAGCTAGGATATGTATTGTAGCCAATGTCTGTACTGGCTTGTGCTTCCT
CCATCATGCCAAGCCAACGCCCGTGGCTCATGGCAACCTGAACCCTTCAAAAATCCTTCTTGATTATAACTATATGGCGAAAATCCATGGTGTTAGGACA
CCTTCTGTCATGTGGACAGATCGAATAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.964475
Expected error %
0.358
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g65500.1 Score 113 E Value 1e-25 Identity 18.10% Align. Length 308bp (49.04%) Frame 2
68418.m08240 protein kinase family protein contains Pfam profile: PF00069 Eukaryotic protein kinase domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g12000.1 Score 99 E Value 1e-21 Identity 15.00% Align. Length 326bp (51.91%) Frame 2
68418.m01403 protein kinase family protein contains protein kinase domain, Pfam:PF00069
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_201353.1| Score 113 E Value 4e-24 Identity 18.10% Align. Length 308bp (49.04%) Frame 2
protein kinase family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB87673.1| Score 99 E Value 6e-20 Identity 15.00% Align. Length 326bp (51.91%) Frame 2
putative receptor-like kinase [Arabidopsis thaliana] ref|NP_196761.1| protein kinase family protein [Arabidopsis thaliana] pir||T48559 probable receptor-like kinase - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0107K14
Clone
Clone name
hba-107k14
LE_HBa0107K14
C11HBa0107K14
P107K14
Clone type
BAC
Contamination
none
Estimated length
161,186
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found