Clone Read LE_HBa0001C13_T7_122

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0001C13_T7_122
Primer
T7
ID from Seq. Facility
Le-HBa001_C13-T7.ab1
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
770 trimmed for vector and quality, 1428 raw
Genbank Accession
Sequence
>LE_HBa0001C13_T7_122 (raw untrimmed)
GTACCCGGGTCGGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCCGAGGGAAATCTTTTTTGTCTTCCACGTAAAAATCCTAGGGATGTG
ATCAGATACTTTAACAACAACTTTCACATCAAACTTCAAACAACATTTATAGATCCACAATTACAAAGCAAGTGGAAAATCATATAACCTAAAATACTTC
CCATCGTGTTTGATCTTAGTGTGCAAATGCAGAATAATTATGTCAAAAGTCTTTCCTTTCAATTACAGCAATGGTTCATTCTTTAGAAAGGATGATTGAA
TGTATGTAGAACAATATAGCAAACTTCACAACATCATCATAATTTGTCACGACCCAAAATGAGCCGTGAGTGGCACCCACACTTATCCTATTATGTGAGC
GAACCAACCAATCTAAACCCCAACATTTCAACTATAATAAACAGAATATAATGCGGAAGACTTAAAACTCATTAACGAAATCAATTAAATAACTTCTAAA
ACTCCATACTTATCATTCCCCAAAACCTGGAAGTCATCATCACAAGAACATCTATCGTCAAATCACTAAATCTAAGAGTATCTAAGAAGCTAAAATAAGT
AAAAGAGATGGTCCATGTCCGAACTTCAAGACATCAAGACGTGAAAGAAAGAATCCAGTCCGAGCTAGGAACAATAGCTCACCCTGAAATCTGATTATGC
TGAAGTCTGGCTAGAGTTGCGGTTGAGTTAAAGACGACGGCACGTTTGCTGCACTCCACAATAAATAAAGAAAGAAACATACAAGTAGGGGTCAGTACAA
GGCACAACTACTTAGTAGGTATCATCGGCCAACTCAAAATAGAAAGCAATATATATCAGATAATAACATAAAATCAACTACAATACTCAACAGTTTAACG
ACAACCAGTACCATAACCCTTAACCCACAACCCAAGCACATTTATGAAGAATTCACGCCTCCACCCCATACCCCTTTTGGGAAAAAAGGTTCTTTAAGTT
TTGAGTATATTAAAAATAATTTCAAAATTCATTTTTTTTTATTCTTTTTGGTTTGGAAACGGGAACCCCCCAATTCCCCAAAAATAACGGGTTGGGTTCC
GGGAACCCCCAATCCCCAAAAAAAAAACGTGTCGGTTCCCCGAAACCCGAATTCCCTAAAAAACAAATGGGTTCTTTTTCGGAAACTCCGAATTCCCCCA
AAATACAACAGGGTTCAATTTCTTGGAACCCCCCGAATCCCCCCAAAATAATAACCGGTGTGTGGGGTTTGGTGGAAACCCCCCGCATATCCCCCCAATA
AAAACAAAGGTTGGTGTTGGGGTTTTTGTGGGGACACCCCCCCAAAAATCCCCACAAAAAAAAAAATATATATATATTGGTGTGGGGTTGTGTTGGTGGA
GGAAACACACCCCCACACAAACTACACC
>LE_HBa0001C13_T7_122 (trimmed for quality and cloning vector)
CTAGAGTCGACCTGCAGGCATGCAAGCTTAGCCGAGGGAAATCTTTTTTGTCTTCCACGTAAAAATCCTAGGGATGTGATCAGATACTTTAACAACAACT
TTCACATCAAACTTCAAACAACATTTATAGATCCACAATTACAAAGCAAGTGGAAAATCATATAACCTAAAATACTTCCCATCGTGTTTGATCTTAGTGT
GCAAATGCAGAATAATTATGTCAAAAGTCTTTCCTTTCAATTACAGCAATGGTTCATTCTTTAGAAAGGATGATTGAATGTATGTAGAACAATATAGCAA
ACTTCACAACATCATCATAATTTGTCACGACCCAAAATGAGCCGTGAGTGGCACCCACACTTATCCTATTATGTGAGCGAACCAACCAATCTAAACCCCA
ACATTTCAACTATAATAAACAGAATATAATGCGGAAGACTTAAAACTCATTAACGAAATCAATTAAATAACTTCTAAAACTCCATACTTATCATTCCCCA
AAACCTGGAAGTCATCATCACAAGAACATCTATCGTCAAATCACTAAATCTAAGAGTATCTAAGAAGCTAAAATAAGTAAAAGAGATGGTCCATGTCCGA
ACTTCAAGACATCAAGACGTGAAAGAAAGAATCCAGTCCGAGCTAGGAACAATAGCTCACCCTGAAATCTGATTATGCTGAAGTCTGGCTAGAGTTGCGG
TTGAGTTAAAGACGACGGCACGTTTGCTGCACTCCACAATAAATAAAGAAAGAAACATACAAGTAGGGGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959179
Expected error %
0.280798
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0001C13
Clone
Clone name
hba-1c13
LE_HBa0001C13
P001C13
Clone type
BAC
Contamination
none
Estimated length
108,372
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
3 sequencing reads found