Clone Read LE_HBa0137F06_T7_122228

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0137F06_T7_122228
Primer
T7
ID from Seq. Facility
LE_HBa_137_F06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
450 trimmed for vector and quality, 817 raw
Genbank Accession
Sequence
>LE_HBa0137F06_T7_122228 (raw untrimmed)
CCTCGGGTACCCGGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTATGTAAGTATGCTAGAGCTATTGTCTAAAAGAACTATATGTTTATGT
TAAGCATGCTAACTTTGTAATATGATGAATGAAGATGTTAGCATGTTTAGAAGTCAATGTTATGAAAATGGTGATTATGTGAAAGGTGTTCTCACAAGCA
CACACACTCACACTTTGTATGAATGAATTAATGAAGCTAAAGAATGTGAATGACAAGGGGAGTTTTGGGGTGAACACTCTTCGTGAGTTGAGATGAAGTG
TTTAGTAGAAATCTCACTATTCCCAAGATCTTTCTAAGATACATTGGAGGTCGCATACCCATTGTTAGTTGAAATGTGGTTTTCCAATACGACCTCTATG
GATAAGTATCATTCGTGAGTTGAGAAGTTGTACTCATTAGCTATCCCTTGACCTAAAGTAATGAATTCTTAAGACTCCATGGGGGAGTTAGTCTTAGCTC
CCACAGGATATGAACAAGGGGTTGTTTTACTTCTTGCGTTAAGACGTTGCTTTCCATTAGTACCTCTTTATATCAGTTTTCGTTTTTTATTGTATAATGA
TTTTATTTCATCATCTTTTCTCTATCATCTTTCTTATTCTCCTATTTTGTTCCGTATCTTTTATTACCCTTTTCAACCCTTTCCTATTTACTTTCTTTCA
CCCCAAGCTTTGACAACCTTCTCTCCTATTGGCCTGTTTTCTTGTCCTTCTCTCTCCCCTCTCCTACTCTTCCGCTCTTTTCTTCCTTCCCACTTCCTCT
TATGTTTAAATCTTTGG
>LE_HBa0137F06_T7_122228 (trimmed for quality and cloning vector)
AGCTTGTTATGTAAGTATGCTAGAGCTATTGTCTAAAAGAACTATATGTTTATGTTAAGCATGCTAACTTTGTAATATGATGAATGAAGATGTTAGCATG
TTTAGAAGTCAATGTTATGAAAATGGTGATTATGTGAAAGGTGTTCTCACAAGCACACACACTCACACTTTGTATGAATGAATTAATGAAGCTAAAGAAT
GTGAATGACAAGGGGAGTTTTGGGGTGAACACTCTTCGTGAGTTGAGATGAAGTGTTTAGTAGAAATCTCACTATTCCCAAGATCTTTCTAAGATACATT
GGAGGTCGCATACCCATTGTTAGTTGAAATGTGGTTTTCCAATACGACCTCTATGGATAAGTATCATTCGTGAGTTGAGAAGTTGTACTCATTAGCTATC
CCTTGACCTAAAGTAATGAATTCTTAAGACTCCATGGGGGAGTTAGTCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.953312
Expected error %
0.4846
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0137F06
Clone
Clone name
hba-137f6
LE_HBa0137F06
P137F06
Clone type
BAC
Contamination
none
Estimated length
90,302
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found