Clone Read LE_HBa0137J06_T7_122324

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0137J06_T7_122324
Primer
T7
ID from Seq. Facility
LE_HBa_137_J06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
667 trimmed for vector and quality, 817 raw
Genbank Accession
Sequence
>LE_HBa0137J06_T7_122324 (raw untrimmed)
CCTCGGATCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCCTATTACCAGTGGTGAGTCCCCTCTTAGCCCTTGTCTTCATTTGACCACT
CGCTCTCAAAACCTACTTAGCTCATTAAACATTCTGCAGATGTTCCCGAAGGATGTGTTATTATAAAGGAGCATATTCCCATCACAAATCTGTTCACCTG
TCTGTGGTTCAATGAAGTTGACCGTTTTACCTCTAGGGACCAACTGAGCTTTTCCACTGTCAGGGACAAATTGATGGCAAAAGTTAGCTGGAACGTCAAC
ATGTTTTTGGATTGTGAGAGGCGAAATTTCGTGATACAGGTATCCATCCACAAGGGAAAATCCCCCCTTACGTTGGATACAATGTTTTACGGTTTAGCTT
AGTTACTTGCCTTAATTTTTGCTGTTCAGTACATACAATACTTTCGCATAGTAAAAGAGCATATACCAAATCTATGCAGGCATACCACAGAGATTTACTG
GAGCAAAGGGCTCACATGACAGTAGTGAGAAGTCGTGCACATCCTCCACCGGCTTTGGTTCGTGATAGTTCTTCTAGTAAACCTCCAGTAAGGAGACCTC
CAAAGCGCGGAAAAGGTGAAAGGAAGTCTAACTCAAGGCGACATCGTAAAGTTGGGTCTGGGAGTAAGGAAATCAGTACTACATTTTGATATTCTTGCCT
TTCATTTTTTTTGGGAAGCAAAAATAGAAAAATCTTTTTATACTAACCTGATTTTGTTCCTTCCTATTGGATTGAACAAATATGTATAGGATAATTTTCG
ATAGGTTCTTTTTTTAA
>LE_HBa0137J06_T7_122324 (trimmed for quality and cloning vector)
AGCTTCCTATTACCAGTGGTGAGTCCCCTCTTAGCCCTTGTCTTCATTTGACCACTCGCTCTCAAAACCTACTTAGCTCATTAAACATTCTGCAGATGTT
CCCGAAGGATGTGTTATTATAAAGGAGCATATTCCCATCACAAATCTGTTCACCTGTCTGTGGTTCAATGAAGTTGACCGTTTTACCTCTAGGGACCAAC
TGAGCTTTTCCACTGTCAGGGACAAATTGATGGCAAAAGTTAGCTGGAACGTCAACATGTTTTTGGATTGTGAGAGGCGAAATTTCGTGATACAGGTATC
CATCCACAAGGGAAAATCCCCCCTTACGTTGGATACAATGTTTTACGGTTTAGCTTAGTTACTTGCCTTAATTTTTGCTGTTCAGTACATACAATACTTT
CGCATAGTAAAAGAGCATATACCAAATCTATGCAGGCATACCACAGAGATTTACTGGAGCAAAGGGCTCACATGACAGTAGTGAGAAGTCGTGCACATCC
TCCACCGGCTTTGGTTCGTGATAGTTCTTCTAGTAAACCTCCAGTAAGGAGACCTCCAAAGCGCGGAAAAGGTGAAAGGAAGTCTAACTCAAGGCGACAT
CGTAAAGTTGGGTCTGGGAGTAAGGAAATCAGTACTACATTTTGATATTCTTGCCTTTCATTTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.981644
Expected error %
0.6508
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g28240.1 Score 129 E Value 1e-30 Identity 26.60% Align. Length 206bp (30.88%) Frame 3
68414.m03466 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53040.2 Score 125 E Value 2e-29 Identity 26.20% Align. Length 209bp (31.33%) Frame 3
68414.m06006 expressed protein contains Pfam profile: PF04765 protein of unknown function (DUF616)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF98431.1| Score 129 E Value 6e-29 Identity 26.60% Align. Length 206bp (30.88%) Frame 3
Unknown protein [Arabidopsis thaliana] ref|NP_174145.1| expressed protein [Arabidopsis thaliana] pir||E86408 F3H9.11 protein - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL32582.1| Score 129 E Value 6e-29 Identity 26.60% Align. Length 206bp (30.88%) Frame 3
Unknown protein [Arabidopsis thaliana] gb|AAN72102.1| Unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0137J06
Clone
Clone name
hba-137j6
LE_HBa0137J06
C07HBa0137J06
P137J06
Clone type
BAC
Contamination
none
Estimated length
79,015
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found