Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0137K15_T7_122357

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0137K15_T7_122357
Primer
T7
ID from Seq. Facility
LE_HBa_137_K15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
650 trimmed for vector and quality, 812 raw
Genbank Accession
Sequence
>LE_HBa0137K15_T7_122357 (raw untrimmed)
TTTGGGTACCGAGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACAATGGATGGCGTTATAGCCTATGTGGTGCGATGGTACCTGGATTGATC
ATAACTGTAGGCTCCCTCCTCCTCCCAGAGACTCCAAACTCTATTATTGAACGTGGAAACAACGAGGAGGCTAAGATGAAGCTCAAGAGGATTAGGGGTG
TTGATGATGTGGACGAAGAGTTCAATGATTTAGTCGTGGCTAGTGAAGTCCTCGAGGAAAGTTGAACATCCTTGGAAAAACTTGTTGCAAAGAAAGTATA
GACCACATCTCACTATGGCTATTGCTATTCCATTTTTCCAACAACTTACTGGGATCAATGTGATCATGTTTTACGCCCCCGTCTTGTTCAAGACTATAGG
TTTTGGTGCTGATGCTTCACTTATGTCTGCTGTTATTACTGGTATAGTCAATGTTGGTGCTACCATTGTCTCGATCTATTATGTCGATAAGTTAGGAAGA
ATATTTTTGTTCCTTGAAGGTGGAATTCAAATGCTCATCTGTCAAGTAAGTTTCAAAATTTCATTCTCTTACCATAGTTTTGTTGAAAACCGTTCTGTTT
CCATGGCTTGAACCTGTAAAATTTGGTGTACGTGTTATATACATGCAATCTCACTTCACTTGCTAGTCTACATGACATCACTTTTGTCTATTGCAGATAG
CTGTTGCAATATCTTTTTCAACATATTTTGGAAACATTTTGGTTATGCACGGGAATACCCCAAGTGGAATGCAACTTAAGAATTAATTTGTTATTATTTT
CTTGTTCCAGAA
>LE_HBa0137K15_T7_122357 (trimmed for quality and cloning vector)
AGCTTGACAATGGATGGCGTTATAGCCTATGTGGTGCGATGGTACCTGGATTGATCATAACTGTAGGCTCCCTCCTCCTCCCAGAGACTCCAAACTCTAT
TATTGAACGTGGAAACAACGAGGAGGCTAAGATGAAGCTCAAGAGGATTAGGGGTGTTGATGATGTGGACGAAGAGTTCAATGATTTAGTCGTGGCTAGT
GAAGTCCTCGAGGAAAGTTGAACATCCTTGGAAAAACTTGTTGCAAAGAAAGTATAGACCACATCTCACTATGGCTATTGCTATTCCATTTTTCCAACAA
CTTACTGGGATCAATGTGATCATGTTTTACGCCCCCGTCTTGTTCAAGACTATAGGTTTTGGTGCTGATGCTTCACTTATGTCTGCTGTTATTACTGGTA
TAGTCAATGTTGGTGCTACCATTGTCTCGATCTATTATGTCGATAAGTTAGGAAGAATATTTTTGTTCCTTGAAGGTGGAATTCAAATGCTCATCTGTCA
AGTAAGTTTCAAAATTTCATTCTCTTACCATAGTTTTGTTGAAAACCGTTCTGTTTCCATGGCTTGAACCTGTAAAATTTGGTGTACGTGTTATATACAT
GCAATCTCACTTCACTTGCTAGTCTACATGACATCACTTTTGTCTATTGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973368
Expected error %
1.643
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g21480.1 Score 169 E Value 9e-62 Identity 80.40% Align. Length 495bp (76.15%) Frame 1
68417.m03106 glucose transporter, putative similar to glucose transporter (Sugar carrier) STP1, Arabidopsis thaliana, SP|P23586; contains Pfam profile PF00083: major facilitator superfamily protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g11260.1 Score 166 E Value 5e-63 Identity 80.00% Align. Length 489bp (75.23%) Frame 1
68414.m01289 glucose transporter (STP1) nearly identical to glucose transporter GB:P23586 SP|P23586 from [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA47324.1| Score 184 E Value 2e-69 Identity 86.70% Align. Length 504bp (77.54%) Frame 1
monosaccharid transporter [Nicotiana tabacum] pir||S25015 monosaccharide transport protein MST1 - common tobacco
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAA79761.1| Score 174 E Value 4e-64 Identity 85.00% Align. Length 489bp (75.23%) Frame 1
sugar carrier protein pir||T10122 hexose transport protein STC - castor bean sp|Q41144|STC_RICCO Sugar carrier protein C
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0137K15
Clone
Clone name
hba-137k15
LE_HBa0137K15
C03HBa0137K15
P137K15
Clone type
BAC
Contamination
none
Estimated length
107,982
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found