Clone Read LE_HBa0004J14_SP6_1226

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0004J14_SP6_1226
Primer
SP6
ID from Seq. Facility
LE_Hba_004_J14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
632 trimmed for vector and quality, 1250 raw
Genbank Accession
Sequence
>LE_HBa0004J14_SP6_1226 (raw untrimmed)
GGCCTTCCTTTGGAATTACAATGCGTGGAGGTTGCATATAGAGCAGAAAAGGAGATTGACTCTAAATCAATAGAAGTTGTACGCGCAAAAACAGATACTT
TGCGAGGCAGAGCTTTTTGGAAACTGAGTTGTTTCTTGGAACAAGTGGTAGAAAACATAGATTCCATCATGAAGGAGTGGATGGCAATCCGGGATGGGTG
CAACAACATGAAAGAGTATATGATTGTCTCAGAATCGAGCAAAAGTTTTTTGGCAAAAACTGAAATGAGACAAGGACTAACGTTTTGGAAACGAGCAGTA
GGACACGTTGATTCGATGATGAACAAGTGGAGAAAGAAGCAGAGCATTTGCACCAAAAGCAAAGATGTAGAAGCACAGAATTTGACTCTTGGGAGTACAT
CTCGACATTCCTTGGAGCATGAGAATGTGATGGTTGGCCATGAAAATGAATTCGAGATGATGCAAGATCAACTTACTAGAGGTGCCAGTGATCTTGAAGT
TGTCTCAATTGTTGGAATGGGTGGCATAGGTAAGACAACTTTGGCTAACAAAATTTACACTGACCCGTTCGTTATGTCTTGTTTTGATAAACGTGCAAAA
GTCACCATCTCACAAGATTATTGTGTGAGAAATGTACTCCTACGTCTTCTTTCTTCCATAAGTGGAAAGACTCATCAAACTTTATGAGGAGCAAGATGAT
GGGCAACTAGCAAACCAGTTGCAAAAGCTTCTAAAAAGCCCGAGGTACTTGGTAGTCATTGTTGACATTTGGACTACTGGAACTTGGAATGAATTAAAAC
TATGTTTGCCAGAACTGTAATTTTAGAATCCAAAATCTCCATAATCAACCTCAAATATGGAAGGCGGCCAAAAAAGTAATCACTAGAAATTCCCCCTTTA
TCAAATCCACCCCTTAAATTTCACAATAAATTTGAAAAAAGTTCTTGGGAAAGAGTTTTTACCGACAGAATTTTTCCCCCAAAAAATTTAGCGAAAGAGG
AAACAAAATGCAGATAAAAAATTAAAAGGTAAAAATACGAGGAGATAGTAAAGGAGAACATGAACAAAAAACGGCGGATTAGGGGCAAATATAAAAACAG
AGCAGGAAATATACCCCAAAAAAGACAATAGAAATGACATTCAATCTCGATATTTTGTTTTTGTAATATATAGAAGAAGGTTAATAAGTGTGAAATCATT
GTCTGTTCGTTTTTTAGTCAATATATTGTGGCTGTTTATTCATTATTTTA
>LE_HBa0004J14_SP6_1226 (trimmed for quality and cloning vector)
TGGAGGTTGCATATAGAGCAGAAAAGGAGATTGACTCTAAATCAATAGAAGTTGTACGCGCAAAAACAGATACTTTGCGAGGCAGAGCTTTTTGGAAACT
GAGTTGTTTCTTGGAACAAGTGGTAGAAAACATAGATTCCATCATGAAGGAGTGGATGGCAATCCGGGATGGGTGCAACAACATGAAAGAGTATATGATT
GTCTCAGAATCGAGCAAAAGTTTTTTGGCAAAAACTGAAATGAGACAAGGACTAACGTTTTGGAAACGAGCAGTAGGACACGTTGATTCGATGATGAACA
AGTGGAGAAAGAAGCAGAGCATTTGCACCAAAAGCAAAGATGTAGAAGCACAGAATTTGACTCTTGGGAGTACATCTCGACATTCCTTGGAGCATGAGAA
TGTGATGGTTGGCCATGAAAATGAATTCGAGATGATGCAAGATCAACTTACTAGAGGTGCCAGTGATCTTGAAGTTGTCTCAATTGTTGGAATGGGTGGC
ATAGGTAAGACAACTTTGGCTAACAAAATTTACACTGACCCGTTCGTTATGTCTTGTTTTGATAAACGTGCAAAAGTCACCATCTCACAAGATTATTGTG
TGAGAAATGTACTCCTACGTCTTCTTTCTTCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951454
Expected error %
0.0602922
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB55838.1| Score 144 E Value 2e-33 Identity 18.10% Align. Length 440bp (69.62%) Frame 1
NBS-LRR protein [Solanum tuberosum] gb|AAF04603.1| disease resistance protein Gpa2 [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB56299.1| Score 143 E Value 4e-33 Identity 18.10% Align. Length 440bp (69.62%) Frame 1
NBS-LRR protein [Solanum acaule]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0004J14
Clone
Clone name
hba-4j14
LE_HBa0004J14
C12HBa0004J14
P004J14
Clone type
BAC
Contamination
none
Estimated length
136,209
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found