Clone Read LE_HBa0151J14_SP6_123100

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0151J14_SP6_123100
Primer
SP6
ID from Seq. Facility
LE_HBa_151_J14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
331 trimmed for vector and quality, 1013 raw
Genbank Accession
Sequence
>LE_HBa0151J14_SP6_123100 (raw untrimmed)
CCAAAACAACTTATGCGGTTTGGTATTTGTTTTATAATTCCAAGAAAATGGTAGATCAACGAGGATGTAGCAAATCGTATAGCGCGATTGATGAAATATA
GGCTCGCATCCAGTGTCCTATTGATACTATTGTGTCACCGAAACCTAAAGGTAAGTTCTATAGAGTGGTTGTTAGACCGACTGTGTTGTACTGGGTGTAG
TGTTGGCTAGTCGTGAAGTCACACCTTCAAATAGCAGAAATGAGGATTCTTAGATGGATGACCAGTCAAGAAGATATATGGGGCAAGGTGAGTGTAGCCA
CGGTGATAGACAAGATGCGAAAAGCGATGTTGAGATGGTTCGTACATGTGAATAACAGAAGCTCAAATGCCCTAGTGAGGAGGTCCAAGAGGTCAACGGT
GATACGCTTGACTAGATGTAAAGGTAGACTCAAGTAAGAATCGGAGAAACGTGATTACACAAGACATTGTCACATCTTCAGCGCAATGAGGACATAACCC
TGGAGATAAGATAGCATATAAGCCGAGTATTTAGGGTATAAAGGGTGTATCTATGATTTCAGCTACATTGGTTGCACCATAACCGTAAATATTTTCTTTT
CATGTACATTTGATCGTGTTTGCATTTTAACGCCCGTAAGCGTAAATCATCACCTCTCACTTAACATGAATCGTTACTACCGATTCGTACTATGCGGTTA
TACGTCGTGGTCGTATTTCAGTGTTGCTTATGTCACATGATACTCTGTTAAACGTTTTATGTTACTTTCTCCTATCTTATATTCCTGGTCTTTACTTCTT
CGCTTGCGTATTCATTTCTCCACCTCCCTGTTCCATAGTTGCTCGTTTTTTATCGACCGCTATTAGATCACACTATCATTACAACAATAACAGTCAACAC
CTCATTTATCCAATTTCTCACAGCGGACTATCTCATCTTATACAATCTTGCTTTCTTCGGACCATTTTCTTGCAGTGCTTCGGTATCTTTCCACTGGGTT
CTCAATTCTTTTG
>LE_HBa0151J14_SP6_123100 (trimmed for quality and cloning vector)
AAATATAGGCTCGCATCCAGTGTCCTATTGATACTATTGTGTCACCGAAACCTAAAGGTAAGTTCTATAGAGTGGTTGTTAGACCGACTGTGTTGTACTG
GGTGTAGTGTTGGCTAGTCGTGAAGTCACACCTTCAAATAGCAGAAATGAGGATTCTTAGATGGATGACCAGTCAAGAAGATATATGGGGCAAGGTGAGT
GTAGCCACGGTGATAGACAAGATGCGAAAAGCGATGTTGAGATGGTTCGTACATGTGAATAACAGAAGCTCAAATGCCCTAGTGAGGAGGTCCAAGAGGT
CAACGGTGATACGCTTGACTAGATGTAAAGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957749
Expected error %
0.3625
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40504.1| Score 95 E Value 5e-19 Identity 19.90% Align. Length 260bp (78.55%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40500.1| Score 89 E Value 3e-17 Identity 19.20% Align. Length 260bp (78.55%) Frame 1
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0151J14
Clone
Clone name
hba-151j14
LE_HBa0151J14
P151J14
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found