Clone Read LE_HBa0151P04_SP6_123234

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0151P04_SP6_123234
Primer
SP6
ID from Seq. Facility
LE_HBa_151_P04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
469 trimmed for vector and quality, 930 raw
Genbank Accession
Sequence
>LE_HBa0151P04_SP6_123234 (raw untrimmed)
TTCCGGGGTTATTCCTATTCGAGTTATAATCCAAGAAAATGGTAGATCAACGAGGATGTAGCAAATCGTATAGCGCCATGGATGAAATATAGGCTCGCAT
CCAGTGTCCTATTGATCCTAATGTGTCACCGAAACCTAAAGGTAAGTTCTATAGAGTGGTTGTTAGACCGACTGTGTTGTACTGGGTGTAGTGTTGGCTA
GTCGTGAAGTCACACCTTCAAATAGCAGAAATGAGGATTCTTAGATGGATGACCAGTCAAGAAGATATATGGGGCAAGGTGAGTGTAGCCACGGTGATAG
ACAAGATGCGAAAAGCGATGTTGAGATGGTTCGTACATGTGAATAACAGAAGCTCAAATGCCCTAGTGAGGAGGTCCAAGAGGTCAACGGTGATACGCTT
GACTAGATGTAAAGGTAGACCAAGTAAGAAGCGGAGAAACGTGATTACACAATACATGACACATCTTCAGCTCAATGAGGACATAACCCTGGAGATAAGA
TAGCATACAAGTCGAGTATTATGGTACAAAGGTGTATCTAGAATTTTAGCTAGATGGTTGCACAATAACGAAAATATATCTTATATATAAATTTGATCTG
CTTCGGATTTAGAGTTGTTAACATAAATAACTGAATATTTCAAAATTATCACAATATCAACAGCTTCCAATATTCATATCCTCCGCAAGATAATACGCCC
TCCACACTGGTCGGACTTGTTTCGCATGTCGACAACTAACATCTGAAGACAAACGTAATTATGACTAAACAAATAATACCCAAATTCATGTAGCTGTAAA
TCAATGTTATCAATAAACAATTTTATATCATATACTAGAACTGACAAGCTTTCTTGCGGACTATCCGTCCTGAGATATAAACAAAAAGGAGAAACGAATA
AACATATAAATAAATAATACAGATTAATTA
>LE_HBa0151P04_SP6_123234 (trimmed for quality and cloning vector)
AGAAAATGGTAGATCAACGAGGATGTAGCAAATCGTATAGCGCCATGGATGAAATATAGGCTCGCATCCAGTGTCCTATTGATCCTAATGTGTCACCGAA
ACCTAAAGGTAAGTTCTATAGAGTGGTTGTTAGACCGACTGTGTTGTACTGGGTGTAGTGTTGGCTAGTCGTGAAGTCACACCTTCAAATAGCAGAAATG
AGGATTCTTAGATGGATGACCAGTCAAGAAGATATATGGGGCAAGGTGAGTGTAGCCACGGTGATAGACAAGATGCGAAAAGCGATGTTGAGATGGTTCG
TACATGTGAATAACAGAAGCTCAAATGCCCTAGTGAGGAGGTCCAAGAGGTCAACGGTGATACGCTTGACTAGATGTAAAGGTAGACCAAGTAAGAAGCG
GAGAAACGTGATTACACAATACATGACACATCTTCAGCTCAATGAGGACATAACCCTGGAGATAAGATA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964493
Expected error %
0.5168
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40504.1| Score 116 E Value 4e-28 Identity 52.00% Align. Length 448bp (95.52%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40500.1| Score 91 E Value 3e-20 Identity 57.50% Align. Length 328bp (69.94%) Frame 2
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0151P04
Clone
Clone name
hba-151p4
LE_HBa0151P04
P151P04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found