Clone Read LE_HBa0163A15_T7_123269

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163A15_T7_123269
Primer
T7
ID from Seq. Facility
LE_HBa_163_A15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
323 trimmed for vector and quality, 830 raw
Sequence
>LE_HBa0163A15_T7_123269 (raw untrimmed)
CCCAGACTCGGTACCCGCGGGGTCCTCTAGGAGTCGACCTAGCAGGCTCGCAAGCTTCGACACGNGACTCAACTTAGATAAACCAGAAACCAAAAATATT
CTCCTTCTACCCTCTACTTCCAAACACAAGGATTGAAGGCTCTTAAGCTCTGCAAGTGAATTACATAATTGATTCATGTCTAGGTTATCAGCACTTCCAA
TGAGTAAACCAACTTTTTGGAGATGAGTCATTCTAGTCAGGTTTTGATGGTGCATCCAGTGATGAACAGGTATGCTGCCTAGAGTTTGGAGATTGTTAGG
TAGGTCAATCTTCAATAGGCTGGGGGAATTTATGTAACCAAGTATATGCCGTAAATTCTCTAACTTCCATAAGACATTAGGAACTTTCACAGATTAAAAC
CTATACATGGGCGCATCTATCATTTCCAAGCTTTGCTGATTATTCATTGAATGGTGAATTTTCTTAATCTTGTTTTCCTTCATTTGTCATTTACTTCAAG
GAACATCTCTCCCATACCTGTATGAAGTCCTTCTTTACCTTATGATTCTATGATACGTACTCCGAGTTTTTCAACTCCACCGTCTCCTTCTATCATGTAT
ACTAGTACACTTTCTGCACTACTATAGATACTTCAGTTAAGTTACATGCTTACGTATTTGAGCGAGCCCACGTACAATTTATTCGTCATCGCCCAGGCGA
CCCGCCCTTTATTGTAATCCGATTCAAATAATCTTTATATTGATTTCTGCTTAGTCCAGCCTCGTGGATGCTCGACGATCCATGTCCCTAGTTGTGTGTT
CAGATACGTACTTGACCATATAGTATAGTA
>LE_HBa0163A15_T7_123269 (trimmed for quality and cloning vector)
GACTCAACTTAGATAAACCAGAAACCAAAAATATTCTCCTTCTACCCTCTACTTCCAAACACAAGGATTGAAGGCTCTTAAGCTCTGCAAGTGAATTACA
TAATTGATTCATGTCTAGGTTATCAGCACTTCCAATGAGTAAACCAACTTTTTGGAGATGAGTCATTCTAGTCAGGTTTTGATGGTGCATCCAGTGATGA
ACAGGTATGCTGCCTAGAGTTTGGAGATTGTTAGGTAGGTCAATCTTCAATAGGCTGGGGGAATTTATGTAACCAAGTATATGCCGTAAATTCTCTAACT
TCCATAAGACATTAGGAACTTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961255
Expected error %
0.3217
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163A15
Clone
Clone name
hba-163a15
LE_HBa0163A15
P163A15
Clone type
BAC
Contamination
none
Estimated length
70,267
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found