Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0163B13_T7_123291

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163B13_T7_123291
Primer
T7
ID from Seq. Facility
LE_HBa_163_B13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
189 trimmed for vector and quality, 825 raw
Sequence
>LE_HBa0163B13_T7_123291 (raw untrimmed)
CTAGATCTGGTACCCGAGGGATCCTCTAATAGTCGACTNGCAGTGCTCGCAAGCTTTTGAAAATAGACTACATGTGATGGCCGAGTACTTCTACAATCGA
GTGCAAAATGTGATAACAAAGTATAGCATTGAACGGCACTGGCTATCCTTGAATGAAGAAACTGGTGGCATGAATGATGTTCTTTATAAGTTATACAGTG
TAACGGTACGTATATTATGTCAAATGAACTTCCTTACAATTTTTTCATCTTTCTAGTTTCTGTTGTATAATTTTTGTTCCAGTTGATGTCGATGTCACAA
ATGAGCACACATGAAATGATTTCATTTTCGGAACACACATCTGGATTTGAATTCGACACAATCGAATCAATACACATCATTCATTTCTACTTTTTTTATA
TTCATTTCTTTGTATACTTTAATATCTTTTTTTCTTCTTATCCGTCCTGTCTATTCACTTTCTCTCTTACTACTTTACTTTTTATACTTCTATTTTTTCT
TTCTTAAGATGCACTTCCCTCTCCTAACCCACCTCTCACATATCCCTCTCTCCCTCCGCCGTATTATTTTGCTTAATCTCATTTATCTTTTCTTTCTTGT
TTGACATGTTCATATACTTTATTTTATTTATATCTATAATATTTGATCCCTTACTTCTCTCTTATCTTTTTATCTTCATTTCTCTTTTTTTCTCTTTTAC
TTTTGCATCAATTTCACTACTCGACTCCTACTACATAACAACGTACTTTCTCTTTACTCTACGTTCCTGAAAACTATCAAGACGACATACTCTGTCTTAC
ACATTTCCTCCTCTATTTTTTTCTT
>LE_HBa0163B13_T7_123291 (trimmed for quality and cloning vector)
GTACTTCTACAATCGAGTGCAAAATGTGATAACAAAGTATAGCATTGAACGGCACTGGCTATCCTTGAATGAAGAAACTGGTGGCATGAATGATGTTCTT
TATAAGTTATACAGTGTAACGGTACGTATATTATGTCAAATGAACTTCCTTACAATTTTTTCATCTTTCTAGTTTCTGTTGTATAATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940106
Expected error %
0.5235
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g12960.1 Score 80 E Value 2e-16 Identity 29.20% Align. Length 119bp (62.96%) Frame 3
68418.m01486 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g12950.1 Score 76 E Value 3e-15 Identity 27.50% Align. Length 119bp (62.96%) Frame 3
68418.m01485 expressed protein putative secreted protein SCF41.30c, Streptomyces coelicolor, EMBL:SCF41_30
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB88260.1| Score 80 E Value 2e-14 Identity 29.20% Align. Length 119bp (62.96%) Frame 3
putative protein [Arabidopsis thaliana] pir||T49910 hypothetical protein T24H18.130 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO42255.1| Score 80 E Value 2e-14 Identity 29.20% Align. Length 119bp (62.96%) Frame 3
unknown protein [Arabidopsis thaliana] ref|NP_196800.2| expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163B13
Clone
Clone name
hba-163b13
LE_HBa0163B13
P163B13
Clone type
BAC
Contamination
none
Estimated length
78,791
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found