Clone Read LE_HBa0163E02_T7_123352

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163E02_T7_123352
Primer
T7
ID from Seq. Facility
LE_HBa_163_E02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
656 trimmed for vector and quality, 884 raw
Sequence
>LE_HBa0163E02_T7_123352 (raw untrimmed)
GTCTACTCGGGTCCGAGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGACAAGGTTTGGGTGTTGTCTATCTGAGATCATGCCTATCTCATTGA
CAAATTCACGATTTCTTTGCTTTGACTTGGAAGACAGCTGCTTAACAGCTATGATGGCACCATCGGCGAGTACACCCTACAGATAGCAATATTCACAACA
ATCATATTACAGACAGAAGAAGGATATGAGTTACTTCAATTATTACTACTCTATTTTTCCTATAAACATGACATCGAGGATAACCAGTAGGAAATATCAC
CAAAAAACCGCAAGCTGTCCTTATGCAAAATCAGTATGGATAGAGAATTGATACCTTGTAAACTGGTCCAAACCCTCCTTCACCAATTTTGTTGGCAGGA
TCAAAGTTATTAGTAGCAGCTTTAATTTGTCTAAGTCTAAAATGACCTGTTTGTAAATCAAGGGCTCTGAGTTCTGTAAACGAGATGAACATTGCAAACG
TCAGTATATATAGATCTTCTAAAACATCTGTATGATGAAAAACAACTTTTAAAAGAATGAACATCTGTATGACGAAGACAGTTTAAGACGTCATGAGCAT
TTAATCGTGTGCTAAGTATCTATGATACGACATGATGTCGATCCACCAACAGAACATTCTTCTCTATGCCGGTCAATTACAGGGGAGATAATTATTTGTA
TCTCACGGCTATAAATCTCCTAAATGATTTCTGATTACACAACCTAACTATCCCCCTATTTTCAATATTCTAAAGTGAAAAAGGCTTCGAAAAAGAGATT
ACCCAATTCCATCTTGGAATTTTTCCCTCCAAAATGGTCTTTTCCCCAATCAAATAAACTCACCAAACGTCTATATTTGATGCT
>LE_HBa0163E02_T7_123352 (trimmed for quality and cloning vector)
AGCTTGACAAGGTTTGGGTGTTGTCTATCTGAGATCATGCCTATCTCATTGACAAATTCACGATTTCTTTGCTTTGACTTGGAAGACAGCTGCTTAACAG
CTATGATGGCACCATCGGCGAGTACACCCTACAGATAGCAATATTCACAACAATCATATTACAGACAGAAGAAGGATATGAGTTACTTCAATTATTACTA
CTCTATTTTTCCTATAAACATGACATCGAGGATAACCAGTAGGAAATATCACCAAAAAACCGCAAGCTGTCCTTATGCAAAATCAGTATGGATAGAGAAT
TGATACCTTGTAAACTGGTCCAAACCCTCCTTCACCAATTTTGTTGGCAGGATCAAAGTTATTAGTAGCAGCTTTAATTTGTCTAAGTCTAAAATGACCT
GTTTGTAAATCAAGGGCTCTGAGTTCTGTAAACGAGATGAACATTGCAAACGTCAGTATATATAGATCTTCTAAAACATCTGTATGATGAAAAACAACTT
TTAAAAGAATGAACATCTGTATGACGAAGACAGTTTAAGACGTCATGAGCATTTAATCGTGTGCTAAGTATCTATGATACGACATGATGTCGATCCACCA
ACAGAACATTCTTCTCTATGCCGGTCAATTACAGGGGAGATAATTATTTGTATCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.968862
Expected error %
0.9635
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53430.1 Score 74 E Value 9e-14 Identity 85.70% Align. Length 423bp (64.48%) Frame 1
68414.m06056 leucine-rich repeat family protein / protein kinase family protein contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g53440.1 Score 74 E Value 9e-14 Identity 85.70% Align. Length 423bp (64.48%) Frame 1
68414.m06057 leucine-rich repeat family protein / protein kinase family protein contains Pfam domains PF00560: Leucine Rich Repeat and PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF78445.1| Score 74 E Value 4e-12 Identity 85.70% Align. Length 423bp (64.48%) Frame 1
Contains a weak similarity to disease resistance protein (cf-5) gene from Lycopersicon esculentum gb|AF053993 and contains multiple leucine rich PF|00560 repeats and protein kinase PF|00069 domain. EST gb|T04455 comes from this gene. [Arabidopsis thaliana] pir||D96574 hypothetical protein T3F20.24 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_175748.1| Score 74 E Value 4e-12 Identity 85.70% Align. Length 423bp (64.48%) Frame 1
leucine-rich repeat family protein / protein kinase family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163E02
Clone
Clone name
hba-163e2
LE_HBa0163E02
P163E02
Clone type
BAC
Contamination
none
Estimated length
172,289
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found