Clone Read LE_HBa0163E14_T7_123364

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163E14_T7_123364
Primer
T7
ID from Seq. Facility
LE_HBa_163_E14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
310 trimmed for vector and quality, 863 raw
Sequence
>LE_HBa0163E14_T7_123364 (raw untrimmed)
CTCAAGCTCGGTACCGGGGGGATCCTCTAGGAGTCGACCTNGCAGGCTNGCAAGCTTTCCAGCAGGCACACCGAAGACACATTTTAGCCGGATTCAGTTT
TAGATTGTACTTGCGTAGCCTGGCAAAGAATTTCCGTAAATCCTCCAAATGATTTAAACTTTCCTTTGATTTGATGATGACATCATCCACATAAACTTCA
ATTTCCTTATGGATCATGTCGTGAAACAAAGTAGTCATCGCTCTCATGTACGTAGCTCCAGCGTTCTTTAGTCCAAAAGGCATCACCTTGTAGTTATAGA
CGCCCCACGGCGTGATGAAAGCGGTTTTCTCAGCGTCGTCTTTGTGCATCTCAATTTGATGATAGCCGGCAAAGCAATCCACAAACGACTGAGTTTCGTG
CTTAGCACAATTTTCAATCAGTAAGTGTATGCTTGGTAATCGAATGAAGTTTATATACATATTGCTGATTGTACTCCATTTGTTTCAACACATTCACAAC
ATACAACCCAATCTTCGTTTATCTCAGTACTAACGCTAACCATACTCCAGACCGGGTGGGTGGAGATGGCCCGCGGCAAGTGGGTCTCATAGCGTGTGGA
TTGTGCTAGTAAGATATAGGGAGACATATCGTCATGCCTAAGTCATTATCGACGGTCGCACTTTTCTCTCGTTGAAAAACATACACTCATCATGTTCGGA
CAAGTAATAATACGATTAGAATAGATCTAATAATTCTCTCCACCACCTTAGTATATGACTGTGCCATTTGCCACCGATCTAAGATAACTTACGTATTGAC
TGTGGCTCATGTCAGTGATGACATAAGCCGACCGTCTGTATATTTAGCGCGCACGCCGAGACG
>LE_HBa0163E14_T7_123364 (trimmed for quality and cloning vector)
AAGCTTTCCAGCAGGCACACCGAAGACACATTTTAGCCGGATTCAGTTTTAGATTGTACTTGCGTAGCCTGGCAAAGAATTTCCGTAAATCCTCCAAATG
ATTTAAACTTTCCTTTGATTTGATGATGACATCATCCACATAAACTTCAATTTCCTTATGGATCATGTCGTGAAACAAAGTAGTCATCGCTCTCATGTAC
GTAGCTCCAGCGTTCTTTAGTCCAAAAGGCATCACCTTGTAGTTATAGACGCCCCACGGCGTGATGAAAGCGGTTTTCTCAGCGTCGTCTTTGTGCATCT
CAATTTGATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967612
Expected error %
0.4385
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 160 E Value 1e-38 Identity 79.60% Align. Length 309bp (99.68%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89777.1| Score 144 E Value 1e-33 Identity 25.10% Align. Length 278bp (89.68%) Frame 3
gag-pol polyprotein-like [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163E14
Clone
Clone name
hba-163e14
LE_HBa0163E14
C10HBa0163E14
P163E14
Clone type
BAC
Contamination
none
Estimated length
115,860
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found