Clone Read LE_HBa0054J09_SP6_12352

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0054J09_SP6_12352
Primer
SP6
ID from Seq. Facility
LE_HBa_054_J09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
569 trimmed for vector and quality, 911 raw
Genbank Accession
Sequence
>LE_HBa0054J09_SP6_12352 (raw untrimmed)
TAAACGAATGAAGAAAAAAATACTCGAAAGCACAGAGAACCTGTAAGAGAACAAACCCTTTGGAGAGGACGAGCGCATGAAGTGAGGTGGTTACGCACCT
AGTTGAAGAGCTTCTCTCGATTAAGTGAATGGAGTTCCATGCGAATCATCGGAGGAGACATGGATGATGGCCAAGAAGAAGCCATTACAGAGGTTACCAC
CGATCAAGCCGTGGCCCTAATCGAGGAGTTAGAAATAACAGCAGATTATTAAATGGCCGTGAGCCGGCGAGTCTTTTCACAAAATTAAGGGCCGTTTGGA
TGGGCATAATAAAAATTACTTTAAAAAATGATGAAACTTATTTTTAAAATAAGTAATTATGCGTTTGGATAAAAGTGTTGAAGGTGATATGTCTAATTTG
AAAAGGGAAAAATGGAAGAAAGAGATGTTATGGTTATATGGGTAATTTGGAGATTGTATAGAAATATTAAGGCCAAAAAGATAAAAATGTGGTCAACTTA
AAACAGCTTATAAGCTAAAAAAAACACTCTTACCCCAGCTTTTTACTTTTGGCTTAAAATAAGTTTTTTTAACTTAAAATAAATTATTTTGAGTATTGTC
AAACAGCTAAAATAAGTCAAAAATCAGTTTTTCAGTCAGTTTGACCAGCTTTTAAGTTGAGCCATACCGGCTCTAAGGGTCTTTGTCGTTTCTTTTTGGA
CCATCGATGAATAGTGTCCAATCCTTATTTTACTGGGGCCATTTTTCCCTTACGCTAATAAACAAATATTTTTGTTTCCTCTACCCAAATGTCCTAATCC
CCCCCCTTAGCTTACACATCAATGGACAACTTGCCCATGTAAACTCCAGAGATTATTCCCTATTCTCGTTTGCACGCGGTGGAGAAATACCCCCGGCTTC
CGGGGCGTGTT
>LE_HBa0054J09_SP6_12352 (trimmed for quality and cloning vector)
AAGCACAGAGAACCTGTAAGAGAACAAACCCTTTGGAGAGGACGAGCGCATGAAGTGAGGTGGTTACGCACCTAGTTGAAGAGCTTCTCTCGATTAAGTG
AATGGAGTTCCATGCGAATCATCGGAGGAGACATGGATGATGGCCAAGAAGAAGCCATTACAGAGGTTACCACCGATCAAGCCGTGGCCCTAATCGAGGA
GTTAGAAATAACAGCAGATTATTAAATGGCCGTGAGCCGGCGAGTCTTTTCACAAAATTAAGGGCCGTTTGGATGGGCATAATAAAAATTACTTTAAAAA
ATGATGAAACTTATTTTTAAAATAAGTAATTATGCGTTTGGATAAAAGTGTTGAAGGTGATATGTCTAATTTGAAAAGGGAAAAATGGAAGAAAGAGATG
TTATGGTTATATGGGTAATTTGGAGATTGTATAGAAATATTAAGGCCAAAAAGATAAAAATGTGGTCAACTTAAAACAGCTTATAAGCTAAAAAAAACAC
TCTTACCCCAGCTTTTTACTTTTGGCTTAAAATAAGTTTTTTTAACTTAAAATAAATTATTTTGAGTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.941969
Expected error %
0.796055
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0054J09
Clone
Clone name
hba-54j9
LE_HBa0054J09
P054J09
Clone type
BAC
Contamination
none
Estimated length
129,246
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found