Clone Read LE_HBa0163O04_T7_123594

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163O04_T7_123594
Primer
T7
ID from Seq. Facility
LE_HBa_163_O04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
675 trimmed for vector and quality, 857 raw
Sequence
>LE_HBa0163O04_T7_123594 (raw untrimmed)
CCCAACCTCGGGACCGAGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTAATATTAAAGCCTTCACCCTTTATTAGCATTTTAGTCCCTCAAA
GATATGTGTATAATATGATTTTGGTCTTCATACTCTTTAATTAATTATATATTAATTTTTTTTAATTAATTAATTAATATGCACACTTGTGATAACAATA
AACTCATTGTATTCCTATTGGTGGAGGTATATGAAAGAGTAAAGCGTATACTGGCCTTATTTTTTACCGTAAAAAGCTTTAAAAATTGTTTCTGATAGAA
TCTCAAGTTAGATACCGTGAAACCTCATAAATTTAACGATTTATTAAGTGTTAAATAAATGTAATTTTTTTAAAAAATAATCTTAATATCATATATTTAC
TTTATGAGTGTATCCAAAGTGTACATCTTAGTTAATTGAAAATTAGGTGGTTGTTTAAACATAAAATGTAATATTTGTAAAATGATATTTGATTAGTTGA
AGTGTATTTAGACATATATTTCGCTAATTTTTATTTTTTTTTAAAAATATTTGTGAGTGAAAAAACCTGAAAAATTAATCATAATAATCCAATTTTCCAA
CTTGAAACTCCTTAAAAACGATAAATCTACAATGCTTCACTACCTACTAGCCTTTCCCTCTTAATTTGAAACCCACTTCTCCTCCTATTAGTTGTAATCC
ATTATCCCTTTTGACTACCTGCTGCATGTCTCATGTTATTTCATGGTCTCATTTCTTAAAATCTTTTTTTTCCACGTGAACTTCGCTTTTGAACTGAATG
GTTACCAAAAAAAATCCCGAAACATCTACCCTATCCATCCCTCCAAAATAAGTCAAT
>LE_HBa0163O04_T7_123594 (trimmed for quality and cloning vector)
AGCTTTTAATATTAAAGCCTTCACCCTTTATTAGCATTTTAGTCCCTCAAAGATATGTGTATAATATGATTTTGGTCTTCATACTCTTTAATTAATTATA
TATTAATTTTTTTTAATTAATTAATTAATATGCACACTTGTGATAACAATAAACTCATTGTATTCCTATTGGTGGAGGTATATGAAAGAGTAAAGCGTAT
ACTGGCCTTATTTTTTACCGTAAAAAGCTTTAAAAATTGTTTCTGATAGAATCTCAAGTTAGATACCGTGAAACCTCATAAATTTAACGATTTATTAAGT
GTTAAATAAATGTAATTTTTTTAAAAAATAATCTTAATATCATATATTTACTTTATGAGTGTATCCAAAGTGTACATCTTAGTTAATTGAAAATTAGGTG
GTTGTTTAAACATAAAATGTAATATTTGTAAAATGATATTTGATTAGTTGAAGTGTATTTAGACATATATTTCGCTAATTTTTATTTTTTTTTAAAAATA
TTTGTGAGTGAAAAAACCTGAAAAATTAATCATAATAATCCAATTTTCCAACTTGAAACTCCTTAAAAACGATAAATCTACAATGCTTCACTACCTACTA
GCCTTTCCCTCTTAATTTGAAACCCACTTCTCCTCCTATTAGTTGTAATCCATTATCCCTTTTGACTACCTGCTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.897764
Expected error %
1.7877
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163O04
Clone
Clone name
hba-163o4
LE_HBa0163O04
C12HBa0163O04
P163O04
Clone type
BAC
Contamination
none
Estimated length
144,268
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found