Clone Read LE_HBa0163P02_T7_123616

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0163P02_T7_123616
Primer
T7
ID from Seq. Facility
LE_HBa_163_P02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
734 trimmed for vector and quality, 835 raw
Sequence
>LE_HBa0163P02_T7_123616 (raw untrimmed)
CCCTACCTTGGTCCCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGTGGTCCACCACTTTTGGCTTTAAGTGACCAACACTTAAGGGTGAC
GGGTCGTGGTTCCTTTCACGACCTATGGACCCCTACGTGGTTTATCACATTTATATTGTGCAGGCTTAGATATTTTTTAAGGTGTTACAATATCTCTTCC
TTGGAAACACTTTTCCTCGAATGAAGTCTAGATAAAATGAGTATGGACAGAAGGATATATAATCCCTACCACTAATTACTAGAAACTGATATATTAATGA
ACTGAGTTCCAAGAACATGATTATATGCTAAAATGCAAGAATAACTGGGGGAATAAGAAATTATATGAGTAAATTGGGAAAGTGGAAAGGAACTGTTGCC
TCAAGATGAAAAAGAATCGAAAGGGAATAGGTGAGAATACTTGTCCATCATTGCTTTTTCTGTTTACCAAGTAGCTTCTTTTACGGACTTACTCCTCCAC
AAAACTTTCATTGACGCGACTTTCTTATTTCTCAACTTACGAACTTGACAGTCACTAGTTTTAACTAGCACCTGTTCATAAGTGAGACTATCCTTCACAG
CCACACTCTCTGATTTTACTATTGATGACATATCACCCACACACTTCTTCAACAAGGAAATATGAAAGACTAGATGAACCGCTTCTAATTCTGCTCGCGA
CTCTAACTCATACGTCATTATACAAACCCTTTTTAAGAATATGTATTGGACAAATATATCTAGGAATGAGCTTCCTTTTCTTTCCAAATTTCCCCTCCCC
TTCTTAACTTGACATTTCGGAAATCCCATCCATTT
>LE_HBa0163P02_T7_123616 (trimmed for quality and cloning vector)
AGCTTCGTGGTCCACCACTTTTGGCTTTAAGTGACCAACACTTAAGGGTGACGGGTCGTGGTTCCTTTCACGACCTATGGACCCCTACGTGGTTTATCAC
ATTTATATTGTGCAGGCTTAGATATTTTTTAAGGTGTTACAATATCTCTTCCTTGGAAACACTTTTCCTCGAATGAAGTCTAGATAAAATGAGTATGGAC
AGAAGGATATATAATCCCTACCACTAATTACTAGAAACTGATATATTAATGAACTGAGTTCCAAGAACATGATTATATGCTAAAATGCAAGAATAACTGG
GGGAATAAGAAATTATATGAGTAAATTGGGAAAGTGGAAAGGAACTGTTGCCTCAAGATGAAAAAGAATCGAAAGGGAATAGGTGAGAATACTTGTCCAT
CATTGCTTTTTCTGTTTACCAAGTAGCTTCTTTTACGGACTTACTCCTCCACAAAACTTTCATTGACGCGACTTTCTTATTTCTCAACTTACGAACTTGA
CAGTCACTAGTTTTAACTAGCACCTGTTCATAAGTGAGACTATCCTTCACAGCCACACTCTCTGATTTTACTATTGATGACATATCACCCACACACTTCT
TCAACAAGGAAATATGAAAGACTAGATGAACCGCTTCTAATTCTGCTCGCGACTCTAACTCATACGTCATTATACAAACCCTTTTTAAGAATATGTATTG
GACAAATATATCTAGGAATGAGCTTCCTTTTCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.959038
Expected error %
1.4243
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38724.1| Score 118 E Value 2e-25 Identity 18.90% Align. Length 317bp (43.19%) Frame 3
putative retrotransposon protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 114 E Value 3e-24 Identity 18.20% Align. Length 317bp (43.19%) Frame 3
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0163P02
Clone
Clone name
hba-163p2
LE_HBa0163P02
P163P02
Clone type
BAC
Contamination
none
Estimated length
94,336
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found