Clone Read LE_HBa0168A23_T7_123661

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0168A23_T7_123661
Primer
T7
ID from Seq. Facility
LE_HBa_168_A23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
259 trimmed for vector and quality, 685 raw
Genbank Accession
Sequence
>LE_HBa0168A23_T7_123661 (raw untrimmed)
AAGTGGCTAAATCTTTAAGAAGAAAGGATTCATCATTAAGAGGATGGGCACCCCAAACGCTGATTCTTGATCACGAGGCTATAGGAGCCTTTTTAACTCA
CTGTGGATGGAATTCGACACTTGAAGGCGTATCAGCAGGGGTTCCAATGGTGACTTGGCCTATATTTGCAGAGCAATTCTTGAATGAGCAATTGATAACT
AAAGTACTACAAATAGGAGTGGCAGTTGGGGCAGAGGAATGGAGCATATTGGTGGATAATGTGAAAAGTGAAGCAATTACAAAGGCAGTGAATTGTGTAA
TGGCTGGGGAATATTTTTGGAAATGATGAGGAATACACAATAAGCTACACTTTGGCTTATTATGGCTGTGGATTAATGTTTATTCTCTTACAGTGATTTG
ACTTATTCTGTTTTTTTGTGTCTTACCTTCTTTTGTGTTTTGCTTTATTTTGTCTTTACTCAATCCTTCCTGTCTTCTTAATTTTATATTTACCTTTTTT
TTTTTTTGCTTTGTCTTTTTTTCTCTTTTTATATGTTAATTTTTTGTTTTATATTATTTTTTTATTTGATTACTATCCATATCTATTATATCTTTTCCAC
AATCTCAACTCTTCTTTTTTGTATATTTTCTATGTATTGTATTCTTCCATCATTTATATTCAAGTTACAAATTTATTTATTATAN
>LE_HBa0168A23_T7_123661 (trimmed for quality and cloning vector)
GATGGGCACCCCAAACGCTGATTCTTGATCACGAGGCTATAGGAGCCTTTTTAACTCACTGTGGATGGAATTCGACACTTGAAGGCGTATCAGCAGGGGT
TCCAATGGTGACTTGGCCTATATTTGCAGAGCAATTCTTGAATGAGCAATTGATAACTAAAGTACTACAAATAGGAGTGGCAGTTGGGGCAGAGGAATGG
AGCATATTGGTGGATAATGTGAAAAGTGAAGCAATTACAAAGGCAGTGAATTGTGTAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959503
Expected error %
1.0298
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g15490.1 Score 113 E Value 2e-26 Identity 25.60% Align. Length 194bp (74.90%) Frame 1
68415.m01772 UDP-glucoronosyl/UDP-glucosyl transferase family protein contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g15480.1 Score 110 E Value 1e-25 Identity 24.60% Align. Length 194bp (74.90%) Frame 1
68415.m01771 UDP-glucoronosyl/UDP-glucosyl transferase family protein contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA59450.1| Score 127 E Value 7e-29 Identity 22.40% Align. Length 254bp (98.07%) Frame 1
twi1 [Lycopersicon esculentum] pir||T07404 probable glucosyltransferase twi1 (EC 2.4.1.-) - tomato (fragment)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD29722.1| Score 127 E Value 7e-29 Identity 22.40% Align. Length 254bp (98.07%) Frame 1
UDP-glucose glucosyltransferase [Catharanthus roseus]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0168A23
Clone
Clone name
hba-168a23
LE_HBa0168A23
P168A23
Clone type
BAC
Contamination
none
Estimated length
114,465
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found