Clone Read LE_HBa0168F12_T7_123770

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0168F12_T7_123770
Primer
T7
ID from Seq. Facility
LE_HBa_168_F12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
650 trimmed for vector and quality, 853 raw
Genbank Accession
Sequence
>LE_HBa0168F12_T7_123770 (raw untrimmed)
CTGGGTCCCGCGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGGCAGTGATTATATGCTGCCCTGTACATAACTAATTCTTGGTACCAACATC
CTTAACGGCGTTAATCTGCTCTTCGCCCATCGCAGACATAACAGACACCACAAGATCCTTTCCTTCCTGGAACCCATCTTTAACCTACATAACATAAAAT
TAACAGATGGAAATAGTGTGAGGAAGTAAGAAAAACGACTTTCACATATAAGTGCATGGGAAGTCATTATTCCATTTGATACTGTATGAAAAGATATTAG
AAGGCATGTTCTGTGCCGTGTTGTCCAGAGTTTATACCTGCTTCAGCAGATTTTCATCGGTGGGAAGCCTGAGGTCATCCTTGGTGTTTCCACTTTCAGT
AAGAAGTGAGACCTAAGACAACAAAATGAACAAATTGCCACAAGAAAGAATCAGCCAAAGAAACCTCTAGCTTTGGAAACAGAACTTCAGGGTATAGAAA
CATGGCAAAATTGCTTCACTTTTGATGAGTTATTTTCCAATATCACTTCCCTACCATTAATCAATTTGATCTTACTAACACCTAAAAAGGTATCATTTCG
TTATTTCTTCTGTGCAACCAGACATAATGTGACATCAATCAGTTTAACCATACCATTTTTGAGCTTAAGAAAATGAAAACGACAAGAAGTTTTCCATGGT
GAAAAAAAATGAATAACTTAAAGGGCTTACCAAAATGATTTCTCTTTGTGGCCCGGACTTCCAAAAGTATTGGCATCAAAATTTTTGGGAGAGTTATGAG
ACTATTGTTGAAACTCTATAAAGTACTTTTTGACTTCATAAAAAGTGTATGTC
>LE_HBa0168F12_T7_123770 (trimmed for quality and cloning vector)
AGCTTTGGCAGTGATTATATGCTGCCCTGTACATAACTAATTCTTGGTACCAACATCCTTAACGGCGTTAATCTGCTCTTCGCCCATCGCAGACATAACA
GACACCACAAGATCCTTTCCTTCCTGGAACCCATCTTTAACCTACATAACATAAAATTAACAGATGGAAATAGTGTGAGGAAGTAAGAAAAACGACTTTC
ACATATAAGTGCATGGGAAGTCATTATTCCATTTGATACTGTATGAAAAGATATTAGAAGGCATGTTCTGTGCCGTGTTGTCCAGAGTTTATACCTGCTT
CAGCAGATTTTCATCGGTGGGAAGCCTGAGGTCATCCTTGGTGTTTCCACTTTCAGTAAGAAGTGAGACCTAAGACAACAAAATGAACAAATTGCCACAA
GAAAGAATCAGCCAAAGAAACCTCTAGCTTTGGAAACAGAACTTCAGGGTATAGAAACATGGCAAAATTGCTTCACTTTTGATGAGTTATTTTCCAATAT
CACTTCCCTACCATTAATCAATTTGATCTTACTAACACCTAAAAAGGTATCATTTCGTTATTTCTTCTGTGCAACCAGACATAATGTGACATCAATCAGT
TTAACCATACCATTTTTGAGCTTAAGAAAATGAAAACGACAAGAAGTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960453
Expected error %
0.4523
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAG53648.1| Score 93 E Value 5e-18 Identity 17.90% Align. Length 329bp (50.62%) Frame 2
eukaryotic translation initiation factor 5A-2 [Lycopersicon esculentum] sp|Q9AXQ5|IF52_LYCES Eukaryotic translation initiation factor 5A-2 (eIF-5A 2)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0168F12
Clone
Clone name
hba-168f12
LE_HBa0168F12
P168F12
Clone type
BAC
Contamination
none
Estimated length
90,720
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found