Clone Read LE_HBa0168F14_T7_123772

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0168F14_T7_123772
Primer
T7
ID from Seq. Facility
LE_HBa_168_F14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
506 trimmed for vector and quality, 873 raw
Genbank Accession
Sequence
>LE_HBa0168F14_T7_123772 (raw untrimmed)
CCGGGTTCCGAGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCATTTATAGCTGGGATTATGGTCTTCGGTGGATTACTTGCCCCAGTAGTA
AGCTCATGAACTCAATTATTTCCTTATCCTTATTCTGGTTCTGCATTATGCATAACGGTACTATGGAGTTATTTATTTCCCTATTCTTGAATGATGAAGT
CTTTCGACTATTGTAACTCTTTGATATTGCAGCTTGAGCTGAAATTAGGTCTAGGAGGCACCTCATACGAAGATTTTATACGTAACATGCATTTGCCTAT
GCAATTGAGGTATGTAAACTGTAACCTGAAGTCCTGAACTACATTTTCATGTGTAGAAAAGGTCGGTGAATTGTTCCTCACAAACATCATTAAATTGTGC
ACATTTGTTCACTGCATTGTTCTTTACCTTCCCAAAAAAGGAGCGTCACAAAATAGAAACAGAAGACCACTTACGTCCTCGTGAATTTGGGTACCGACTT
CTTTTTCTCTTCTTCTCAGCCAGGTCGACCCCTTATTGGCGTCCTTTTCAGGCGGGTCAGTGGGAGTCATCACAGCCCTCATGCTATTATAAGCTAATCA
TTTTAATCTATTCAATAGAAGAAATATTTTTATTATTGTTTTGTTTTTGGTTTTTTCTTGTCAATCTTTTATCATCATATTTCCACTATGTTTACTTCTT
TTTAATACTCTCTATCCTATTTTAAGTAGTTATTTTTTGTATAATTTTATCCTGTAGTATTTAATAATCTTAATTACATATTATTATGTTACTTTAATAT
GTGGTACATATTTTTATCTTGTCATAAATGTTTTATGTTCCTTATCCCTTTTTTTACTTCCTATGCTATTATT
>LE_HBa0168F14_T7_123772 (trimmed for quality and cloning vector)
AGCTTTTCATTTATAGCTGGGATTATGGTCTTCGGTGGATTACTTGCCCCAGTAGTAAGCTCATGAACTCAATTATTTCCTTATCCTTATTCTGGTTCTG
CATTATGCATAACGGTACTATGGAGTTATTTATTTCCCTATTCTTGAATGATGAAGTCTTTCGACTATTGTAACTCTTTGATATTGCAGCTTGAGCTGAA
ATTAGGTCTAGGAGGCACCTCATACGAAGATTTTATACGTAACATGCATTTGCCTATGCAATTGAGGTATGTAAACTGTAACCTGAAGTCCTGAACTACA
TTTTCATGTGTAGAAAAGGTCGGTGAATTGTTCCTCACAAACATCATTAAATTGTGCACATTTGTTCACTGCATTGTTCTTTACCTTCCCAAAAAAGGAG
CGTCACAAAATAGAAACAGAAGACCACTTACGTCCTCGTGAATTTGGGTACCGACTTCTTTTTCTCTTCTTCTCAGCCAGGTCGACCCCTTATTGGCGTC
CTTTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.969199
Expected error %
0.6861
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0168F14
Clone
Clone name
hba-168f14
LE_HBa0168F14
C09HBa0168F14
P168F14
Clone type
BAC
Contamination
none
Estimated length
82,075
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found