Clone Read LE_HBa0168G04_T7_123786

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0168G04_T7_123786
Primer
T7
ID from Seq. Facility
LE_HBa_168_G04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
562 trimmed for vector and quality, 822 raw
Genbank Accession
Sequence
>LE_HBa0168G04_T7_123786 (raw untrimmed)
ACCTGGGACCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCTTAAGGATAAAGTGAGACTATTCTGTGTTTGTTTCTTGTCTTGTCTTT
TAGTTCCAAACAAACGTAAAATTGAGATTTGGAGTGTTCTTTGAATAAGAGAAGAGGCAACATGTGATTTAAAATTTGTAGTTAATTCTACTTAATTATT
CTTAATTTTTTTACTTAACTTTAGTTTTAATTTAAGCTTACCCAATAATGAGACAGGTAATAGTGTTTTTCGAGAAGTTAAAGTTACATAATAGTAATTT
TTAGTTTATCCAAGTTAAAGTTACATAATAGTAATTTTTAGTTTATCTTTAATGTTATGAAAAAGAATTGAAGATTGATAAATAGTTGAATAATATATCA
AAGGAAAGAAATGTCTATTTACCTTAGTGTTCTATAACTTTGTTTTATAATATTTTTACTAACTATTTTTTTTGTATTATTTTTTTTATAATTATATTTT
CATAGTTTTTCTACTGAATCAAAAATCTATTTTTCTCTTTCAAAATAAGGCATACACACATTTAGCTAATAAGGTTAAAACTCTATGATGATTAATGTTA
TTATTTTAGCCATAACAATATTTATATATAGCCAAAGTTTGCTGTGAACTGAAAATTTAATCTCACTTCTTGTTATCCGTTCTTTATGTTTAATTAATAC
AAAAATTAAAATCTAAAAACTCTTTTTCTATTAAAATAATAAAAAAATTAGCTATTTAACACTCATAATCTTAAAAATAACCGCTATCAACTGTGTAAGA
ACTGTTCATATCACTTATTCTT
>LE_HBa0168G04_T7_123786 (trimmed for quality and cloning vector)
AGCTTAGCTTAAGGATAAAGTGAGACTATTCTGTGTTTGTTTCTTGTCTTGTCTTTTAGTTCCAAACAAACGTAAAATTGAGATTTGGAGTGTTCTTTGA
ATAAGAGAAGAGGCAACATGTGATTTAAAATTTGTAGTTAATTCTACTTAATTATTCTTAATTTTTTTACTTAACTTTAGTTTTAATTTAAGCTTACCCA
ATAATGAGACAGGTAATAGTGTTTTTCGAGAAGTTAAAGTTACATAATAGTAATTTTTAGTTTATCCAAGTTAAAGTTACATAATAGTAATTTTTAGTTT
ATCTTTAATGTTATGAAAAAGAATTGAAGATTGATAAATAGTTGAATAATATATCAAAGGAAAGAAATGTCTATTTACCTTAGTGTTCTATAACTTTGTT
TTATAATATTTTTACTAACTATTTTTTTTGTATTATTTTTTTTATAATTATATTTTCATAGTTTTTCTACTGAATCAAAAATCTATTTTTCTCTTTCAAA
ATAAGGCATACACACATTTAGCTAATAAGGTTAAAACTCTATGATGATTAATGTTATTATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.866146
Expected error %
0.5121
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0168G04
Clone
Clone name
hba-168g4
LE_HBa0168G04
C01HBa0168G04
P168G04
Clone type
BAC
Contamination
none
Estimated length
127,804
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found