Clone Read LE_HBa0175B10_T7_124056

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175B10_T7_124056
Primer
T7
ID from Seq. Facility
LE_HBa_175_B10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
2 trimmed for vector and quality, 1733 raw
Sequence
>LE_HBa0175B10_T7_124056 (raw untrimmed)
CTGCCNCGTGAATCAGCCNTGAACTCATCGTACGCTCTCCTACCTCNTGCATCATGCGGGTAGTACAGAGCAGATGATCCATCGATCTTGATCTGCTACA
GNTCNGNAGTCCTAGAGTGGAGAATAAGTACGTGAGATTGNAGNANAANGTATTACGTGAGNGCACACATCACATAATTNACACGAGCTAACTCCTTCCG
TAATCTCCCTGATAGTAGGACTGGCATGATTGAAGAGCATACTATTGTGAGATGTATATAGACACGCAGACNACTGCAGCACACGTATACAGGAGCTGTG
TCGGACAATACAACAGCGCGCGTCGATNGACGCTTGTGAATCGGCGACTCACAATGTATTTCTGCATGAAGTANTAAGGCGCTATAATATAGTGTTGTAT
TGGTCTGGTGGCTTGTACGAGAAAGAACATCGCAGAGGATACAGCCACTCTCTGGNACTGAGAGGCTCGCGGCAGTGCAGGGACATGATGTATGATAGAG
TACCAGTCGTTCGCGACAGTCTGTCTGTGTGGACTTGATGCTTCGTTCGGCGGCCGGCGAGAGTGGTGAGTCTCAGCGATCTCTCGTGCGCACTGTGTTA
TTCTCGTAGTATGCGTNTCGTCTACTGCGACATGACCNCCACTGCTGTGCGACGGACTAGCGTGACATCCACTNGNCTGACGTGGCTGTACTAACATCNG
CTGGGTCGGCTGTTCACTACAGATGGTGATTACTAGTCGATGATCATGTTGCGAGCTGCTGGCGTATGATGGATAGCGCTGCGTGCAGCGGCGCGCGATT
CACGTAACTAATACGTATATCGACCATATACCTGGAGTCCTTGGTGATGTCGCATGTCTGGTCGACGTATTGATGACGAGCTTGCAGATGCTTANCATGC
GCTGTTATCGCACTTGCGGGTGCTGCGCGTGTCAACTGCACGACATCTGACTCGTATCATCGGACTGCGACATAGATAAGCTCGNACGTCGAGCTTGTAA
GTCTTCGGTCCCTCGCTNANGCGCGNGTGAGTTGAGTGTAGTTGCTGCTAGCTACGGCGCTTGCTATGACTTTGTACGCAGCGATATAGGCATAGATATG
GTGGGCGACGCGCTGGGACGACCTTCGCGNGTCATGGTGNGTNGTANGAGTCGAGCGACTACGCTGGATGCTGTGGGTAATGCTANGTCGACGTAATCTA
CACGGATGATGCAACGCTCTGACTAGTCTGACACATACNACTGGACCTTGANTGACGCGTGCTGCTAGGGTTGCATATTCTCTGTAGTGAGTGAGTCGAC
ACAGTGATATACGTGTGACGAGACGTCACGCGTGGATACAGGTCTATATACATATTGTTGCTNTACACGTGCTGTCGTGTCNGTACCGCTTATGCTCTTG
CTGTGTTNGCATGT
ATACATAGACTACAAGATGGTGTNTNTTTGTCATCTTGTGATGCTGCTTAGGTGCTACATATTCGNGCGCTCATGTCTCTACATCT
TATACTACTCTTANTACATTTCGCTATAATATGTGCNACNATGAGNTGATGTNCTTATACGTATAATATCACTACGTGACCACTACTGCATTAGGCGACT
AGNCATGAACTTACAGGTAATATANCCTNGAACTNTGCGACCGTGAACACTCACGTTGTATAGTGAACACGATAGCTCCGAGGGCTGTGGTTTGCATTGC
TGATACATGNACTGTAGCGTGTGAGANTAGTGA
>LE_HBa0175B10_T7_124056 (trimmed for quality and cloning vector)
AT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • High predicted error rate
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
5.3155
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175B10
Clone
Clone name
hba-175b10
LE_HBa0175B10
C03HBa0175B10
P175B10
Clone type
BAC
Contamination
none
Estimated length
116,569
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found