Clone Read LE_HBa0175G03_T7_124169

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175G03_T7_124169
Primer
T7
ID from Seq. Facility
LE_HBa_175_G03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
735 trimmed for vector and quality, 808 raw
Genbank Accession
Sequence
>LE_HBa0175G03_T7_124169 (raw untrimmed)
TGGGTCCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCGAGTTATACTCGTTCAATCTTTTAAACTCTATTGGGCAAACTTATAAGA
CAATTTCTATACACCCTTTTTGTAACAATAGAGTCACCCATCGGACTAGACACTATAAGAGTTTCCTGAAAAATATCGGGTAAAATATCAAATTTTTTGT
CTACTAGAGGAGTAACAATGTATAAAGTGGCACCGGGATCAATTAAGGAATATACTTAAACAGCGAAAATTTTCAACATACAGGTAATCACGTCGGGGCA
AGTCTCTTGCTCAATCCGAGAGCGGAGAGCATAGAAATGGTTCTGCTTCTCATCCTCATTTTTACCACTTACTTTATATTGAACACCATTTTATTACACC
TTTATATTAATGAAATCCCTAACCTTGTTTCCACTCTTAGCACAACAAAGACAATTACCCGTTCTAACCAAGCATTCACCTAAATGACCCTTTTCGCACT
TGGCACATGTAGACTTCTCATGTGGTGAGATTACACTCCTTCCAATTTTACCTCTCCGTTTATTTACCTTTTCATCACAAGCCTTAGGGAACATGGATGG
AACTTAATTAGAAAACCACTTATTAAATCAAGGCTTGTCTTGTTTCTCAAGCCTATTCTTTGAACAACCTCCATCAAAACATCTTGCCCTTTTTGGTAAC
TCTACTATTCCACCTATACCTTGCCTCTTATATATACTTGACATGAACCATATGATAAGAATTTTTTTTTGTCATTTAACATACCCGAATGAAACTCATA
TTTCAATN
>LE_HBa0175G03_T7_124169 (trimmed for quality and cloning vector)
AGCTTATCGAGTTATACTCGTTCAATCTTTTAAACTCTATTGGGCAAACTTATAAGACAATTTCTATACACCCTTTTTGTAACAATAGAGTCACCCATCG
GACTAGACACTATAAGAGTTTCCTGAAAAATATCGGGTAAAATATCAAATTTTTTGTCTACTAGAGGAGTAACAATGTATAAAGTGGCACCGGGATCAAT
TAAGGAATATACTTAAACAGCGAAAATTTTCAACATACAGGTAATCACGTCGGGGCAAGTCTCTTGCTCAATCCGAGAGCGGAGAGCATAGAAATGGTTC
TGCTTCTCATCCTCATTTTTACCACTTACTTTATATTGAACACCATTTTATTACACCTTTATATTAATGAAATCCCTAACCTTGTTTCCACTCTTAGCAC
AACAAAGACAATTACCCGTTCTAACCAAGCATTCACCTAAATGACCCTTTTCGCACTTGGCACATGTAGACTTCTCATGTGGTGAGATTACACTCCTTCC
AATTTTACCTCTCCGTTTATTTACCTTTTCATCACAAGCCTTAGGGAACATGGATGGAACTTAATTAGAAAACCACTTATTAAATCAAGGCTTGTCTTGT
TTCTCAAGCCTATTCTTTGAACAACCTCCATCAAAACATCTTGCCCTTTTTGGTAACTCTACTATTCCACCTATACCTTGCCTCTTATATATACTTGACA
TGAACCATATGATAAGAATTTTTTTTTGTCATTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955
Expected error %
0.3195
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38728.1| Score 108 E Value 2e-22 Identity 12.60% Align. Length 539bp (73.33%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38744.1| Score 103 E Value 3e-21 Identity 12.40% Align. Length 458bp (62.31%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175G03
Clone
Clone name
hba-175g3
LE_HBa0175G03
C02HBa0175G03
P175G03
Clone type
BAC
Contamination
none
Estimated length
52,592
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found