Clone Read LE_HBa0175G05_T7_124171

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175G05_T7_124171
Primer
T7
ID from Seq. Facility
LE_HBa_175_G05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
452 trimmed for vector and quality, 864 raw
Genbank Accession
Sequence
>LE_HBa0175G05_T7_124171 (raw untrimmed)
GGATCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTGGTCGAGATGATGCTTCTGTGTATGCTTCTTAACTCTTCTTTTTTCTGTTT
CTTTTGTGGTTTTTGTGTTGTTAGAAGTTAAAACATGGGATTCTTGAGTACCCCTTTTGTTTTTTCTTGGTAGGGAGTTGAGATTTGGTGGAGTTTTTTT
GGTAAGAACAAGAGAAGATGGGGTTTTTTACTGTCTTTTGCTGCTAAGAAGTAAGAGCAAAATATAGCAGAATTTGTTGAATGTTGTTATACTCATAGAA
ATGAAGGTTGGTTATTGTTTATTTTGTTTTGCATGTGAGAAAAGGAAGTTTAATATGTTTTGAAATCAATTTTTTGACTTAAGGCCCTTTCTGTTCTAAC
CATAGGAGCTGTCTTTTTTTGCTGGTTTCATAGCTTAGGTTGAGCACTAAAGTTTGTTTTTCTAATTTCTTTTTTTGGGGTTTTTGTTGGTACTTTTGGT
AAATTAACATTTTTACTCTCAAATCATCTCCTTGATCATATATGGAATAGTTTATCTCCTTAAAATTGTGTTATATATTTTCTTTATTCGTTTATTGTTA
TTTTTTTTTCTGGTTTTTCTTGCTGAATTTTTCTATATTATTAGGTTTTTATTCTAAATTGTTTGATATTCATTATTTTTCTGTTGTTGCCCTATTAAAT
ATCTACTAGTCTTTATTTCTATTTATGTATAAACCTTGTCCACATTATATGAATTTACTGAACTAAGGTGTTGATTGAATATATTTTTCTTACTTTTTAT
TATTCCTTATTCATTAGTTAATTTTTCAAAATCCTATTATTATTTTATCTAATATAATTATATC
>LE_HBa0175G05_T7_124171 (trimmed for quality and cloning vector)
AGCTTCTTGGTCGAGATGATGCTTCTGTGTATGCTTCTTAACTCTTCTTTTTTCTGTTTCTTTTGTGGTTTTTGTGTTGTTAGAAGTTAAAACATGGGAT
TCTTGAGTACCCCTTTTGTTTTTTCTTGGTAGGGAGTTGAGATTTGGTGGAGTTTTTTTGGTAAGAACAAGAGAAGATGGGGTTTTTTACTGTCTTTTGC
TGCTAAGAAGTAAGAGCAAAATATAGCAGAATTTGTTGAATGTTGTTATACTCATAGAAATGAAGGTTGGTTATTGTTTATTTTGTTTTGCATGTGAGAA
AAGGAAGTTTAATATGTTTTGAAATCAATTTTTTGACTTAAGGCCCTTTCTGTTCTAACCATAGGAGCTGTCTTTTTTTGCTGGTTTCATAGCTTAGGTT
GAGCACTAAAGTTTGTTTTTCTAATTTCTTTTTTTGGGGTTTTTGTTGGTAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.882546
Expected error %
1.1399
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175G05
Clone
Clone name
hba-175g5
LE_HBa0175G05
P175G05
Clone type
BAC
Contamination
none
Estimated length
98,035
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found