Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0175I12_T7_124226

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175I12_T7_124226
Primer
T7
ID from Seq. Facility
LE_HBa_175_I12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
565 trimmed for vector and quality, 853 raw
Genbank Accession
Sequence
>LE_HBa0175I12_T7_124226 (raw untrimmed)
CTGGACCCGGGTGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCACATATTTTATTTTCAGCAAATCTCAGTTTTGGCAGACCTCGGACCAGGTC
CTTAGAAATCACTTTGTTCAATAAAGATGAGCTCACATGCCCTATCCTACAATGACATAGATCAACATTTTCATTTTGAGCACTAAGACATGTCAGGTCA
TCTCCATGAGACGTTTATAAGTTGGCCACATACATGTTTTTACTTCTGAAAGCAGTGAGAATTACCTTCTTTGTAGTTAGACTAACCACAGTGCCTCAGA
AGTAAACTTGACTTTATTTTCTTTGTCACAGATTTGAGACACGCTCAAAAGACTGTACTTCAACCCATCAACATGATACACATTGTCAATTGAATCTTCA
AGAGACCTTCCCACTTTACGAACTCCCAAAATGTACCCCTTCTTTCCATCACCAAAAGAGACACCTCCTCCCTGAAGTGTCTTGAGTGAGAGGAAATTTT
TGATGTCACCAATCATATGTTTAGAGCATCAACTGTCCATATACCAACATTGACTGCTGCTCCTCTCACTCACCTGCATCCAAGAATTACTTGTTTAGAT
TGGGAACCCATTTCAATTTGAGTTCCCCGAAGGCAAACAGAGGAATGATTAAATTGTAATTAGACTATAATGTAATTTTAAAAAATGTATTCGAAAATAT
ATATTTATAGTAATTTATTTTTTATTATGAAAATATATACTATTTTTATACTGCTTTTAGAGTGCCCATTGCTCTTCTTTTTCATATTTTTTTACTTTTT
ATATACTATAATATAAATTTATTCCATAGAATAAATTCTCTTACTTATGAAAT
>LE_HBa0175I12_T7_124226 (trimmed for quality and cloning vector)
AGCTTCACATATTTTATTTTCAGCAAATCTCAGTTTTGGCAGACCTCGGACCAGGTCCTTAGAAATCACTTTGTTCAATAAAGATGAGCTCACATGCCCT
ATCCTACAATGACATAGATCAACATTTTCATTTTGAGCACTAAGACATGTCAGGTCATCTCCATGAGACGTTTATAAGTTGGCCACATACATGTTTTTAC
TTCTGAAAGCAGTGAGAATTACCTTCTTTGTAGTTAGACTAACCACAGTGCCTCAGAAGTAAACTTGACTTTATTTTCTTTGTCACAGATTTGAGACACG
CTCAAAAGACTGTACTTCAACCCATCAACATGATACACATTGTCAATTGAATCTTCAAGAGACCTTCCCACTTTACGAACTCCCAAAATGTACCCCTTCT
TTCCATCACCAAAAGAGACACCTCCTCCCTGAAGTGTCTTGAGTGAGAGGAAATTTTTGATGTCACCAATCATATGTTTAGAGCATCAACTGTCCATATA
CCAACATTGACTGCTGCTCCTCTCACTCACCTGCATCCAAGAATTACTTGTTTAGATTGGGAACC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.953675
Expected error %
0.5979
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_912508.1| Score 54 E Value 2e-15 Identity 36.10% Align. Length 529bp (93.63%) Frame 2
Putative Zea mays retrotransposon Opie-2 [Oryza sativa (japonica cultivar-group)] gb|AAN60991.1| Putative Zea mays retrotransposon Opie-2 [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE03782.2| Score 54 E Value 4e-15 Identity 33.30% Align. Length 532bp (94.16%) Frame 2
OSJNBa0063G07.6 [Oryza sativa (japonica cultivar-group)] ref|XP_471876.1| OSJNBa0063G07.6 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175I12
Clone
Clone name
hba-175i12
LE_HBa0175I12
P175I12
Clone type
BAC
Contamination
none
Estimated length
128,119
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found