Clone Read LE_HBa0175M04_T7_124314

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0175M04_T7_124314
Primer
T7
ID from Seq. Facility
LE_HBa_175_M04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
712 trimmed for vector and quality, 784 raw
Genbank Accession
Sequence
>LE_HBa0175M04_T7_124314 (raw untrimmed)
CTGGACCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCAACGGCTTCTTTGACTTCCCTTGAATGAACAGATCCTCCCATCATCGAAT
CATATATATACCTTTCTACTTTTGATTCGGAATACAACAAGAAACCAATGCAATTTGTCATTGATGTTGACTGGGATGATTACTTCATCAACCCTATCCC
ACGGAATGTTAGCAAGCAACTTATATCCTCTAATGCATTGTCCAACATCATGGTCCGGTGATATGCATCTCATGTCACATTGTGATTGTCTCCACTGTTT
CTCAATGTTATCAACTCATGCTATAAACCAACAATCAACAATACTGTAAGAAGTGACTGTTTGGGAGTATTTTACCTTCTTTCGGAGATAATACATTATT
ATATTAATATGTTGTTTTAACAAAAAAAAATACATATCTGATTCATTCACTATTCACACATATTTCATACAGAAAATATGCATACAGAAAACATACAGAT
ATCACACATATTTCATACAGAAAATATACATACAAAAAACATACATATATCACATATTTCATACAGAAAACATACATACAGAAAACATACATATATCACA
TATTTCATACAAAAAATATACATACAGAAAACATACATATATCACTGCAGCAGCACTGTAAGAAGTTTGTGAGTATTTTGCCTTCTTTCAGATATAATAC
ATTATTGTATTAATATGTTTGTTTTAACAAAAAAAAATACATATTCTAATTCATTCACTGTTCAAACATATTTTCATACAAAAA
>LE_HBa0175M04_T7_124314 (trimmed for quality and cloning vector)
AGCTTATCAACGGCTTCTTTGACTTCCCTTGAATGAACAGATCCTCCCATCATCGAATCATATATATACCTTTCTACTTTTGATTCGGAATACAACAAGA
AACCAATGCAATTTGTCATTGATGTTGACTGGGATGATTACTTCATCAACCCTATCCCACGGAATGTTAGCAAGCAACTTATATCCTCTAATGCATTGTC
CAACATCATGGTCCGGTGATATGCATCTCATGTCACATTGTGATTGTCTCCACTGTTTCTCAATGTTATCAACTCATGCTATAAACCAACAATCAACAAT
ACTGTAAGAAGTGACTGTTTGGGAGTATTTTACCTTCTTTCGGAGATAATACATTATTATATTAATATGTTGTTTTAACAAAAAAAAATACATATCTGAT
TCATTCACTATTCACACATATTTCATACAGAAAATATGCATACAGAAAACATACAGATATCACACATATTTCATACAGAAAATATACATACAAAAAACAT
ACATATATCACATATTTCATACAGAAAACATACATACAGAAAACATACATATATCACATATTTCATACAAAAAATATACATACAGAAAACATACATATAT
CACTGCAGCAGCACTGTAAGAAGTTTGTGAGTATTTTGCCTTCTTTCAGATATAATACATTATTGTATTAATATGTTTGTTTTAACAAAAAAAAATACAT
ATTCTAATTCAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.914597
Expected error %
0.5819
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0175M04
Clone
Clone name
hba-175m4
LE_HBa0175M04
P175M04
Clone type
BAC
Contamination
none
Estimated length
71,420
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found