Clone Read LE_HBa0176B05_SP6_124435

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0176B05_SP6_124435
Primer
SP6
ID from Seq. Facility
LE_HBa_176_B05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
496 trimmed for vector and quality, 991 raw
Sequence
>LE_HBa0176B05_SP6_124435 (raw untrimmed)
GGGGGAATGGTTCTGGTTCTTATTGTTTGCTGTTGTCCTGACTATGAGAATTATGTAGTTGATGAAGGCTTGATGCCTTTACTTCAACGCTTAACACTGA
AATTATATGCCTATTCCTTCTTAAAGGGAGAAGAAGTGCAAGCTCCCAAAAACCCATAGGAACTATATTTGACGTTGCCTTATCATATAAATAACAAATG
CATTCATTCACTAGTCATGTGAAAGCCTAAAACAGAACATCTTAAACCAGAAACAACTCACACCACGAAGTGTGAGAGAAGGGTCATAGAAGGTGTCCAC
AGGACAACAATATATCATTGATTAGGAATGAACACTTGTTTAGTTCAGAGCATAAAAAGATTGGGAATGAGCACTTCTTTGGTTCAAAGCATACAAGATA
ATCAAAAGAGACGACTGCAAGGTCCACGCTTAGCTTAATAACAGCAGGATTTCAGCTAGTCAATCTCAGGAATTCTTCCTATCCAAGTCAGCATTTGACA
CCAAGCAAAGCATAATAGCTCTGTTATACAGTTGCAAGGTACTATGATAGAAGAGATGAATAGAAATAAAACTTCCAATTAGACAAGTCCGAAACCCAGA
GAAACTTATTTTTCAATTACAGCTCCTAAAGCAGCAGTAGATACAATAAATTCCAAAAATGAAAAATATTCTTATAGGGAGAAAGTGTTCGCCAGAAACA
ATGGTTGGAAAGCAAAAGCCCCTGGAAAATAAAAATCCAAAAACAAACATGTCTGCCCCGAAGTCAAAATAAAAGCCAAAGGACCCGCCCCTATTAATAG
CGTCAGGAGGGACTTGTCCGGCACAAATTGTTTGTCTAGAACTTGGAAGGGTGGAAACAAAGTTGTGTCCAAGCTGCCCATAACCCCCATAAATTTTGTG
GTTTAACCAATGTGTTTTTTATAAAAAACCATATATCCCCCACCCGACGATGCTAGGCGGGCCTGGGTCACTAGTCCCTATGGAAAAATTC
>LE_HBa0176B05_SP6_124435 (trimmed for quality and cloning vector)
TGTTGTCCTGACTATGAGAATTATGTAGTTGATGAAGGCTTGATGCCTTTACTTCAACGCTTAACACTGAAATTATATGCCTATTCCTTCTTAAAGGGAG
AAGAAGTGCAAGCTCCCAAAAACCCATAGGAACTATATTTGACGTTGCCTTATCATATAAATAACAAATGCATTCATTCACTAGTCATGTGAAAGCCTAA
AACAGAACATCTTAAACCAGAAACAACTCACACCACGAAGTGTGAGAGAAGGGTCATAGAAGGTGTCCACAGGACAACAATATATCATTGATTAGGAATG
AACACTTGTTTAGTTCAGAGCATAAAAAGATTGGGAATGAGCACTTCTTTGGTTCAAAGCATACAAGATAATCAAAAGAGACGACTGCAAGGTCCACGCT
TAGCTTAATAACAGCAGGATTTCAGCTAGTCAATCTCAGGAATTCTTCCTATCCAAGTCAGCATTTGACACCAAGCAAAGCATAATAGCTCTGTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954476
Expected error %
0.1948
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0176B05
Clone
Clone name
hba-176b5
LE_HBa0176B05
C03HBa0176B05
P176B05
Clone type
BAC
Contamination
none
Estimated length
116,232
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found