Clone Read LE_HBa0176F21_SP6_124547

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0176F21_SP6_124547
Primer
SP6
ID from Seq. Facility
LE_HBa_176_F21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
509 trimmed for vector and quality, 982 raw
Sequence
>LE_HBa0176F21_SP6_124547 (raw untrimmed)
GGGGGCCGGTTAGCAATAAATCTTCAAGGAACTTGAATAATTTATCTTTAAATTATTAAATANTGTGTGATCACAAAACTTTTAAATCTAATCTTAAAAA
GATTCTCAAGTTTCCTTCCCTTTTTTAAGAGAAATTCCATTTCTTCATAGAACTTTCAAAAAAAAATAAAAAAAAAAATGAAATGCATCTCCAATCATTA
CTCTTTTTAATACATTATACTTCGGTGTCTTTATCTTTCAATATCAAATTAAATAATTGACAAACTTTGAAATATTTTTACTTACAAAAACATTTAAAAA
TATGGGCAAAATGGAAAATTTTAATTACTTATATCTTGATTTTATAAAATTAATAAATAAAAATCTTATCTTTAAAAATATTTTTTCAACGATTAAAATA
TCATTATTTTTGTGGTAGAAAATAAAAACCTTTCTACAAAAGAGATAGAAAAAGAGAAAATTTGGTTTATACCTTTAATGTATGGAGTAGGATTGAATGA
AAATTTTGATACTCCCTCTGTATTATAAAGAATATTTAATTTGACTTGACACAAATTTAAAAATATAAAAAAAAATTTAAATCTTATAATCAAAAATTAA
AATTATGTCAAATGTACAAATTATCCTATGATCGGACTTAAAACATGTCATTAAAAAAATTTTAATTAAAATTTCTAAAAAAAATCTTTCCTTTTTTAAC
CCAATTTAAAACGAAAAAGTTTTTTTTAACAATAAAAATAAAAATTGGATTAATATTCATTATGGGGGCAAATTGCGGAAGTCTGGGGTTGCTCTTTTCC
ACACTACTTAAACTTTTATGCGAAATTTAAAAAAACCTGAGAGGACTACATAACTTGGGTCCGCTAGAACTGCCGGTAAACGAAACGGCCCCCCCACATA
CTCACAATCAAAATCCGCGGCCCTCTACACCAAACTAGCCTCGTGTACATAAATTTTAAAGAAAACCTATTTAGGTTTTGCA
>LE_HBa0176F21_SP6_124547 (trimmed for quality and cloning vector)
TTGAATAATTTATCTTTAAATTATTAAATANTGTGTGATCACAAAACTTTTAAATCTAATCTTAAAAAGATTCTCAAGTTTCCTTCCCTTTTTTAAGAGA
AATTCCATTTCTTCATAGAACTTTCAAAAAAAAATAAAAAAAAAAATGAAATGCATCTCCAATCATTACTCTTTTTAATACATTATACTTCGGTGTCTTT
ATCTTTCAATATCAAATTAAATAATTGACAAACTTTGAAATATTTTTACTTACAAAAACATTTAAAAATATGGGCAAAATGGAAAATTTTAATTACTTAT
ATCTTGATTTTATAAAATTAATAAATAAAAATCTTATCTTTAAAAATATTTTTTCAACGATTAAAATATCATTATTTTTGTGGTAGAAAATAAAAACCTT
TCTACAAAAGAGATAGAAAAAGAGAAAATTTGGTTTATACCTTTAATGTATGGAGTAGGATTGAATGAAAATTTTGATACTCCCTCTGTATTATAAAGAA
TATTTAATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.850839
Expected error %
0.7319
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0176F21
Clone
Clone name
hba-176f21
LE_HBa0176F21
P176F21
Clone type
BAC
Contamination
none
Estimated length
113,533
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found