Clone Read LE_HBa0054M02_T7_12483

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0054M02_T7_12483
Primer
T7
ID from Seq. Facility
LE_HBa_054_M02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
510 trimmed for vector and quality, 822 raw
Genbank Accession
Sequence
>LE_HBa0054M02_T7_12483 (raw untrimmed)
GGGGGATCCCTCTAGAAGTCGACCTGCAGGCATGCAAGCTTATTTATTAACAACACAACCTAGATTACAACTAGAATAGAAGACTAGTCATGCTTCACAT
TTGGTGATCATCACCAACACACATTCATAATACAAATGCCTTCAAGGCCATGATCACATCACATATATATTGACAATAAATTAAAAACGGCCACCATAAG
TGGATCTTACCACACAATGCCATACAAGGCAATTATCTAGCAATTCTATAGAGAAACAGAGAGGCAAAGCAATCTTACCAAAACTCCCTTGCTTTGATCA
TCAATAATTACTACTGATAATTCATCAATAATTAACATATAGGGCATTAGATAAAATTACAATAACATAATCGAAATCATAATTTAACCATCATAGGATC
AAGATTACATTATGCACACTACATCATAAATTCTATAGAAAGAAGGAGAATATAGATCAATTCACCAAATCCTCAAGCCTTGATCCACATTGGATCAACT
ATACATAATTCAACATTAATATACATAATTGGCAATAGATTAAGCAATTCAACATGCTAGAATCATAATTCAATCAACTTAAAGTCAACAATGCCCATAA
TATAGGCTAATTTGAGAATTGGACGGAACATCGGTTCCTCACAAAATTGGATTGAACTTTCAAAATCAGTACATAAAAACCCACCTCCTCCTCAGCCATG
CTTTTCAAAACAATTTTTGAGAAACAAACCCCATGGGTTTAGATTCTAAAAAATTTGAAAGGTTTGTTTCCCGAAAATCCTCCCTTGAAAAAGCTTTCTT
AAGAACACTCCTTTCCCAATTT
>LE_HBa0054M02_T7_12483 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTATTTATTAACAACACAACCTAGATTACAACTAGAATAGAAGACTAGTCATGCTTCACATTTGGTGATCATCACCAACACA
CATTCATAATACAAATGCCTTCAAGGCCATGATCACATCACATATATATTGACAATAAATTAAAAACGGCCACCATAAGTGGATCTTACCACACAATGCC
ATACAAGGCAATTATCTAGCAATTCTATAGAGAAACAGAGAGGCAAAGCAATCTTACCAAAACTCCCTTGCTTTGATCATCAATAATTACTACTGATAAT
TCATCAATAATTAACATATAGGGCATTAGATAAAATTACAATAACATAATCGAAATCATAATTTAACCATCATAGGATCAAGATTACATTATGCACACTA
CATCATAAATTCTATAGAAAGAAGGAGAATATAGATCAATTCACCAAATCCTCAAGCCTTGATCCACATTGGATCAACTATACATAATTCAACATTAATA
TACATAATTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.902932
Expected error %
0.268673
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0054M02
Clone
Clone name
hba-54m2
LE_HBa0054M02
P054M02
Clone type
BAC
Contamination
none
Estimated length
78,781
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found