Clone Read LE_HBa0178N09_SP6_125111

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0178N09_SP6_125111
Primer
SP6
ID from Seq. Facility
LE_HBa_178_N09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
580 trimmed for vector and quality, 882 raw
Sequence
>LE_HBa0178N09_SP6_125111 (raw untrimmed)
TTTCGAACAGCCGGGCATTGATTAATCAAAGGTTCTATGCTAAAGCTTGCTTCATACCTTGTATTTAATCCCTTTTGGTGATCTATCTGGGGATGTTTAA
TGCTTCTTATACCTTTATAATATGCAAAAGAGATTCGGCATGATATTATCTACCATCAACCATTTAAAGATTACCTCAAATTAGAAGTGCCGATCAAGTT
TGAATCAATTCTTAGCGAAGCAATGCCTTGGGGGGCCTATTAGTCCGCTACACTACTAATGATAATATTTATTGCTGTTAGCTGCTGATAAATTTAATGA
TGAGATCAACCCCCTTCTGTGATGATCTGATTTTCTTGTACGACATTATTAAGTTTTGTGTCATTTGAATTTCAGTCTTAACTGGCAGCATCAGCTATGC
AAGAATCCACGTCCAAATCCTGATATTAAAACACTTTTTACTGATCATACTTGTGCTTCTAGCAATGGAACTCGGCCTCCTCCTCCTGTAAATACGCCTC
TTGCTGGACCAGTTCCAAAGCCTGGGGCATTTCCTCCACTTGGAGCACACAGTGTGAGTAGAGTTCATTAAACATGTTATTCCCTTAAAAAACGAAACCT
CTTACTTATCTGCCTAACTATTTTGCTATGTTCCATGTGGGATCCCAGTTATTTTAGTTTTTCTTATTACCGCCCATCCCAACCAGTTGTTTCCCCTTCC
CCCAGTGTCACCCGCAGGGTGGATGTCCAAGGTGCAAACCCATTTTATGTCTCACCATGGTGGTTGCTCCTGGGTCCCCCCGGGGACTCGGGGCGGGGCC
TCGGGGTGTTGGGCTGTGTTATTCTTATTTTTTTGTGTTGGAGAAAAAAAATTTAGTGTTGTATCTTTTTCCGGAAAAATGA
>LE_HBa0178N09_SP6_125111 (trimmed for quality and cloning vector)
TAATCAAAGGTTCTATGCTAAAGCTTGCTTCATACCTTGTATTTAATCCCTTTTGGTGATCTATCTGGGGATGTTTAATGCTTCTTATACCTTTATAATA
TGCAAAAGAGATTCGGCATGATATTATCTACCATCAACCATTTAAAGATTACCTCAAATTAGAAGTGCCGATCAAGTTTGAATCAATTCTTAGCGAAGCA
ATGCCTTGGGGGGCCTATTAGTCCGCTACACTACTAATGATAATATTTATTGCTGTTAGCTGCTGATAAATTTAATGATGAGATCAACCCCCTTCTGTGA
TGATCTGATTTTCTTGTACGACATTATTAAGTTTTGTGTCATTTGAATTTCAGTCTTAACTGGCAGCATCAGCTATGCAAGAATCCACGTCCAAATCCTG
ATATTAAAACACTTTTTACTGATCATACTTGTGCTTCTAGCAATGGAACTCGGCCTCCTCCTCCTGTAAATACGCCTCTTGCTGGACCAGTTCCAAAGCC
TGGGGCATTTCCTCCACTTGGAGCACACAGTGTGAGTAGAGTTCATTAAACATGTTATTCCCTTAAAAAACGAAACCTCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964312
Expected error %
0.5789
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g15750.2 Score 108 E Value 2e-24 Identity 24.70% Align. Length 185bp (31.90%) Frame 2
68414.m01890 WD-40 repeat family protein contains 10 WD-40 repeats (PF00400) (1 weak)
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g15750.1 Score 108 E Value 2e-24 Identity 24.70% Align. Length 185bp (31.90%) Frame 2
68414.m01889 WD-40 repeat family protein contains 10 WD-40 repeats (PF00400) (1 weak)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP45184.1| Score 135 E Value 5e-31 Identity 31.20% Align. Length 188bp (32.41%) Frame 2
putative beta transducin-like protein [Solanum bulbocastanum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_480212.1| Score 110 E Value 2e-23 Identity 25.30% Align. Length 185bp (31.90%) Frame 2
WD-40 repeat protein-like [Oryza sativa (japonica cultivar-group)] dbj|BAC99788.1| WD-40 repeat protein-like [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0178N09
Clone
Clone name
hba-178n9
LE_HBa0178N09
P178N09
Clone type
BAC
Contamination
none
Estimated length
80,538
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found